1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Simora [160]
2 years ago
14

____ are a result of hurricanes which push massive amounts of water inland causing severe damage

Biology
1 answer:
Masja [62]2 years ago
4 0
Storm surges is the correct answer
You might be interested in
Arrange the stages of mitosis shown in the diagrams in sequential order. Use the ABCDE labels on the drawings to indicate the or
Igoryamba
The answer is ' B " 
fdgvfddfbfdbdfbfbfg
gfdbdfbdbdgbdbgb
4 0
3 years ago
Read 2 more answers
What is the carbon cycle?
Nataliya [291]
The carbon cycle is carbon compound are inconverted onto the environment
5 0
3 years ago
How long does it take for a ziploc to biodegrade
ASHA 777 [7]

plastic items take up to 1000 years to decompose in landfills. But plastic bags we use in our everyday life take 10-20 years to decompose, while plastic bottles take 450 years.

I hope this helps

8 0
2 years ago
Why is nonpoint source pollution difficult to control?
bixtya [17]

Answer:

because it comes from the everyday activities of many different people, such as fertilizing a lawn, using a pesticide, or constructing a road or building.

Explanation:

6 0
3 years ago
You will need a fork, knife, and a spoon for the "predators" to "catch" the "prey". For the "prey" you will need three different
Yakvenalex [24]

In the simulation, the prey type that will avoid capture the most is the beans while the predator that will succeed in capturing the most prey is the spoon.

<h3>What are predator-prey relationships?</h3>

Predator-prey relationships are feeding relationships in which one organism kills and eats another organism for food.

The organism that kills the other is called the predator while the organism that is killed is called the prey.

In the simulation, the prey type that will avoid capture the most is the beans since it had the smallest surface area and size.

The predator that will succeed in capturing the most prey is the spoon because of its hollow nature.

Learn more about predator-prey at: brainly.com/question/1778577

#SPJ1

5 0
2 years ago
Other questions:
  • Is the dna soluble in the aqueous solution or alcohol?
    9·1 answer
  • What are the elements that are most abundant in biomolecules
    13·1 answer
  • Describe the process of scientific inquiry and explain why it is not a rigid sequence of steps.
    7·1 answer
  • Describe the role of algae in marine biome
    14·1 answer
  • 8. Which is true of the light reaction of photosynthesis?
    9·1 answer
  • Need help on checking my answers! The ones circled in yellow are the ones that I believe the answers are. Please and thank you (
    13·2 answers
  • Which of the following is true about natural selection? ​
    12·1 answer
  • Question 1: When a chemical reaction occurs, what happens to the atoms of the two substances?
    14·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Given the controversy over drilling for oil as well as transporting oil, what is a viable option for the future?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!