1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zepelin [54]
3 years ago
10

Additional Activities Directions: Using the concept map below, identify the type of interaction that exists in mangrove swamps.

Give examples of organisms involved by writing the interaction or organisms in the blank boxes. Do it in your Science Journal? Mangrove Swamp Ecosystem Mutualism Predation oysters attached on mangroves
pa help pls need ko na po ngayun​
Biology
1 answer:
horsena [70]3 years ago
3 0
Do u el dorito so add the nurse to the bag of money
You might be interested in
How could a cell disease-causing bacteria get inside a cell without damaging the cell membrane
grigory [225]

Answer: Bacteria are much larger than viruses, and they are too large to be taken up by receptor-mediated endocytosis. Instead, they enter host cells through phagocytosis. Some pathogens, however, have acquired the ability to survive and replicate within macrophages after they have been phagocytosed.

Explanation: This is my answer

4 0
3 years ago
Yo can someone help me out
Ymorist [56]

Answer: 2

Explanation:

Because it is going from a solid to a liquid.

5 0
3 years ago
The increase in blood flow to exercising active skeletal muscle relative to other organs is largely caused by the
defon

Answer:

muscle contraction increases interstitial fluid pressure and compresses the blood vessels within the active muscle. As a consequence, blood flow is highest when muscles relax between successive muscle contractions.

Explanation:

7 0
3 years ago
I can’t figure this out! Does anyone have a clue what the answer is ??!
adelina 88 [10]

Answer:    point D

Explanation:

7 0
4 years ago
A plant breeder is trying to increase the medicinal quality of belladonna (Atropa belladonna), which is derived from atropine, a
Mandarinka [93]

Answer:

The average amount of atropine in the new population will be 32 units of atropine.

Explanation:

To answer this question, we need to remember how can we calculate the selection differential and the heritability in the narrow sense.

• We can get the selection differential, SD, by getting the difference between the mean value of the population´s units of atropine, PoUA, and the mean value of the parents´ units of atropine, PaUA. So, in this example the selection differential is:

SD = PoUA - PaUA    

SD = 10 - 50  

SD = - 40    

• The heritability in the narrow sense, h², for units of atropine in the population is

h² = units of atropine of the offspring average/selection differential

But we already know the value of h² = 55% = 0.55. And we want to know the units of atropine of the offspring. So we just need to clear the following equation.

OUA = PoUA + h² ( PaUA - PoUA)

where,  

• offspring average units of atropine = OUA

• population average units of atropine = PoUA = 10 units

• parents average units of atropine = PaUA = 50 units

• Selection diferential = SD = -40 units

• narrow sense heritability = h² = 0.55

OUA = PoUA + h² ( PaUA - PoUA)

OUA = PoUA + h² (SD)

OUA = 10 + 0.55 x ( 50 - 10)

OUA = 10 + 22

OUA = 32 units.  

7 0
3 years ago
Other questions:
  • Similarities and differences between prokaryotic and eukaryotic cell division
    7·1 answer
  • Do you think it is acceptable for someone to release old chemicals into a stream? Explain your answer
    9·1 answer
  • What should you do before a lab to be prepared for a accident
    13·2 answers
  • Explain how and when an egg is produced and completes its development?
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • A. What is the average age at which uterine cycles begin? At about what age do they end?
    13·1 answer
  • Which one of the following pollutants is responsible for the increase in skin cancer?
    6·1 answer
  • Que nos ayuda a saber si un cuerpo esta en movimiento
    12·1 answer
  • Data collected from part of a population is a _______.
    15·1 answer
  • In comparison to animals, are humans adapted to their environment?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!