1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elodia [21]
2 years ago
8

Consider a home mortgage of ​$250,000 at a fixed APR of ​4.5% for 30 years. a. Calculate the monthly payment. b. Determine the t

otal amount paid over the term of the loan. c. Of the total amount​ paid, what percentage is paid toward the principal and what percentage is paid for interest.
Mathematics
1 answer:
lianna [129]2 years ago
8 0

Answer:

  a. payment: $1266.71

  b. total paid: $456, 015.60

  c. fraction to principal: 54.8%; fraction to interest: 45.2%

Step-by-step explanation:

<h3>a.</h3>

The amortization formula tells you the monthly payment is ...

  A = P(r/12)/(1 -(1 +r/12)^(-12t))

Payment on principal P at annual rate r for t years.

  A = $250,000(0.045/12)/(1 -(1 +0.045/12)^(-12·30)) ≈ $1266.71

The monthly payment is $1266.71.

__

<h3>b.</h3>

360 monthly payments of $1266.71 will have a total value of ...

  360 × $1266.71 = $456,015.60 . . . . total amount paid

__

<h3>c.</h3>

Of course, $250,000 is paid on the principal. That percentage is ...

  $250,000/$456,015.60 × 100% ≈ 54.8% . . . to principal

The remaining fraction is paid for interest:

  100% -54.8% = 45.2% . . . to interest

You might be interested in
Collins is working.......
lesya [120]
Let n represent the amount Colin earned on Sunday.

On Sat. he earned n/2; on Sun. he earned n; and on Friday he earned (1/2)(n/2).

Then n/2  +  n  + n/4 = $70

Mult. all terms by 4 to eliminate fractions:

2n + 4n + n = $280

7n = $280  =>  n = $40

Colin earned n/2, or $20, on Saturday; n, or $40, on Sunday; and n/4, or $10, on Friday.

Note that $20 and $40 and $10 add up to $70, as they must.
4 0
3 years ago
PLEASE ANSWER ASAP,
sergeinik [125]
The answer is (B)!!!!!!!!!!!!!!!!!!!!!!!!
4 0
3 years ago
Solve for &lt; x &lt; 180degrees
Tamiku [17]

Option C: 90° is the value of x.

Explanation:

The given expression is 4+2 \sin x=14-8 \sin x for 0^{\circ} \leq x \leq 180^{\circ}

We need to solve the expression.

Thus, we have,

4+2 \sin x=14-8 \sin x

Subtracting both sides by 4, we have,

2 \sin x=10-8 \sin x

Adding both sides by 8 sin x, we get,

10 \sin x=10

Dividing both sides by 10, we have,

sin \ x=1

Taking sin^{-1} on both sides of the equation, we get,

x=sin^{-1}(1)

x=90^{\circ}

Thus, the value of x is 90°

Hence, Option C is the correct answer.

4 0
3 years ago
K + 1/3 = 5 1/8<br><br> PLEASE HELP MEEE
Alecsey [184]

Answer:

115/24 =4.7916

Step-by-step explanation:

Based on information provided this is what I think is the answer

5 0
3 years ago
What fraction represents<br> 1/2 x 2/3
son4ous [18]

Answer: 1/3

hope this helped!

8 0
3 years ago
Other questions:
  • Find two numbers whose sum is 49. If the greater is 4 more than 8 times the smaller. Solve
    9·2 answers
  • What is 58.58 repeeting converted
    10·1 answer
  • Which expression is equivalent 3/4(3x-5)
    15·2 answers
  • Find three consecutive odd numbers whose sum is 1875.
    10·1 answer
  • (2x-1)^2 +28=0 square root method
    15·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • If a price tag of 175.00 is 20% off how much is it
    9·1 answer
  • I am making two kinds of cookies: chocolate chip and lemon cookies.
    7·1 answer
  • Shelby charges $12 an hour for lawn care. Over the summer, he earne
    15·1 answer
  • What forms of the following equation in?<br><br> y+5=7(x−3)
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!