1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga_2 [115]
2 years ago
5

In closed circulatory systems, how are nutrients and oxygen transported from the blood to body cells? Does this transport occur

in all parts of the system? Explain.
Biology
1 answer:
RUDIKE [14]2 years ago
5 0

Answer:Through the collective work of active transport, osmosis and diffusion.

Explanation:

these transport occure through plasna membrane.

You might be interested in
Which is the best way to display this data for analysis
Pani-rosa [81]
Data table:) or graph

5 0
3 years ago
Read 2 more answers
A catalyst is a substance that does what?
inysia [295]

The answer is C. A catalyst speeds up the rate of a chemical reaction. However, it is not consumed during the course of the day.

5 0
3 years ago
Which of these organisms would be a producer?
forsale [732]
1)-c it means plants as producer
2)-c consumer take other organism as food so they are consumer
6 0
3 years ago
What type of cells are found in most multicellular organisms like humans
krek1111 [17]

Answer:

Multicellular organisms are composed of more than one cell, with groups of cells differentiating to take on specialized functions. In humans, cells differentiate early in development to become nerve cells, skin cells, muscle cells, blood cells, and other types of cells.

8 0
3 years ago
How did the relative lack of water on land affect how plants evolved?
Sever21 [200]
Plants adapted over time to having less and less water. As they adapted they over the years require less water for them to thrive.
6 0
3 years ago
Other questions:
  • What are some likely reasons the classroom doorknob is among the least infected areas in a classroom
    12·2 answers
  • TRUE or FALSE: The adrenal glands control internal sleep and waking cycles.
    5·2 answers
  • What kind of relationship would a hummingbird and a daffodil have?
    11·1 answer
  • What is a tumor? (1 point) o a mass of cells a stage in the cell cycle O a checkpoint in the cell cycle 0 a cell that results fr
    7·1 answer
  • Geologists generally agree that Earth is ____________. about 100 million years old. about 4.55 billion years old. about 6,000 ye
    5·2 answers
  • Which of the following correctly identifies the main function of photosynthesis?
    9·2 answers
  • sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
    7·1 answer
  • What is the environmental change shown in the image?
    11·2 answers
  • Which portion of a flowering plant absorbs water and minerals? *
    10·1 answer
  • 33. There is never any competition for food or living space among living organisms.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!