1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eva8 [605]
2 years ago
6

Whats are the four main stages of the mealworm lifecycle?

Biology
1 answer:
spin [16.1K]2 years ago
5 0

Answer:

Life Cycle Stages

<em>Mealworm beetles go through four distinct stages of development: egg, larva, pupa, and adult. The amount of time it takes the insects to go through these stages depends on the temperature of their environment and the availability of food.</em>

<em />

You might be interested in
Determine if the following statement is true or false. If true, choose TRUE. If false, choose the rewording that is true.
Aleks [24]

Answer: TRUE

Explanation:

6 0
3 years ago
In meiosis for females the egg cell is much larger than the three polar bodies,why does it need that extra cytoplasm
ELEN [110]
The large cell develop into mature gamete call ovum and it cytoplasm from the egg. The unequal distribution of the cytoplasm during oogenesis is necessary as the zygote that results in the cytoplasm from the egg. So the egg needs to have as much cytoplasm as possible
6 0
3 years ago
What is the best source of vitamin C?<br> - Cheddar Cheese<br> -strawberries<br> -lentils
seraphim [82]
<span>-strawberries i hope dis helps you</span>
3 0
3 years ago
Read 2 more answers
What is the name of the cells that control the opening and closing of the stomota
Butoxors [25]

Answer:

guard cells

Explanation:

they control the opening and closing of the stomata

4 0
2 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • In a study of genetic variation of the Graceland gene, a researcher finds that there are two alleles in a population. In a large
    13·1 answer
  • In what way is the nervous system comparable to electricity?
    14·1 answer
  • Enzymes are made of protein and a non protein therefore they can not be denatured? True or false?
    13·1 answer
  • Why can't all mixtures be classified as solutions?
    14·1 answer
  • 6. Adaptations that result from natural selection are expected to increase the fitness of an organism.
    7·1 answer
  • Lipid molecules that have the maximum number of hydrogen atoms possible are referred to as unsaturated.
    15·1 answer
  • An atom has at least one positive proton and at least one negative electron. Which of the following is true about the protons an
    8·2 answers
  • What type of bone is humerus
    12·2 answers
  • During protein synthesis, what carries amino acids to the ribosome?
    10·1 answer
  • How to be a grown up
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!