1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LekaFEV [45]
3 years ago
11

Dna in daughter cells during mitosis????Does it get halved or remain the same

Biology
1 answer:
stiv31 [10]3 years ago
8 0

Answer:

unless if she was made by 2 guys

Explanation:

You might be interested in
To survive, an organism must be able to maintain stable internal conditions in a changing environment. This process is called ho
Reptile [31]

Answer:

1. Initial air temperature: 0 °C (32 °F)

2. Initial body temperature: 37 °C (99 °F)

3. The expected effect of different factors on body temperature are:

   A. Raising air temperature: Increase

   B. Lowering air temperature: Decrease

   C. Adding clothing: Increase

   D. Exercising: Increase

Explanation:

The question is incomplete, it is necessary to look for a software related to this homework.

<u>Homeostasis is a property of organisms that consists in their capacity to maintain a stable internal condition by compensating for changes in their environment</u> through the regulated exchange of matter and energy with the exterior. It is a a dynamic equilibrium controlled by a mechanism of feedback that constitute the self-regulating mechanisms. Examples of homeostasis are temperature regulation and the balance between acidity and alkalinity (pH)

The Human Homeostasis Gizmo™ is a software that allows you to explore  how the human body stays at a nearly constant  temperature in different conditions.  To use it, you have to set the air temperature at 0 °C (32 °F) and the body temperature at 37 °C (99 °F), and click Play. After a simulation of 1 hour, then click Pause and gather the information. Then, do the same cprocedure  to test the effect of other factors and Click Reset between each trial. To determine the effect of different factors on body temperature, you have to compare the  final body temperature to the final body temperature while  there is no specific movement or change.

Then:

1. Initial air temperature: 0 °C (32 °F)

2. Initial body temperature: 37 °C (99 °F)

3. The expected effect of different factors on body temperature are:

   A. Raising air temperature: Increase

   B. Lowering air temperature: Decrease

   C. Adding clothing: Increase

   D. Exercising: Increase

This is for a logical reason, anything you do to heat it or generate heat, will increase the temperature. And anything you do to generate cold, will lower the temperature.

The effect of different factors on body temperature according to Gizmo:

   A. Raising air temperature: Increase

   B. Lowering air temperature: Decrease

   C. Click Add to a sweatshirt, hat, pants, and  parka. Then, adding clothing:

   Maintained

   D. Set the Exercise level to 70%, then exercising: Increase

When the temperature increases, it is because you are able to record the results from the software and you see temperature goes from 99 °F to 100 °F. When the temperature decreases. it is because it goes from 99 °F to 97 °F. When it is maintained, there is no change.  

5 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Do you think that video games should be banned? yes or no? tell me the reason why?
zimovet [89]
I personally think that video games are not a problem in a normal ‘teenagers’ life but if their parents or guardians are not being responsible it can cause some
Problems however for someone adults who put video games before a job or a relationship that’s 100% a problem so in conclusion you need to be responsible doesn’t matter if your a kid or a adult don’t let video games control your life or your health
3 0
2 years ago
Read 2 more answers
What is the electrical charge of an atom that has gained an electron?
valentinak56 [21]
Its protons because we know electrons= protons so its postive so a)

7 0
3 years ago
Read 2 more answers
A student compares two different proteins. The student notices that the primary structures differ in both the number of amino ac
bagirrra123 [75]
A. The different length and different sequence are a good indication they are front different genes and probably have different functions.
6 0
3 years ago
Other questions:
  • There are well over 600 skeletal muscles in the human body.<br><br> true <br> false
    12·1 answer
  • Generally, single-celled plants may reproduce by
    13·2 answers
  • A child is admitted in the clinic with nausea, vomiting, constipation, hypophosphatemia, and glycosuria. after talking to the pa
    15·1 answer
  • Hereditary monarchies, whereby the crown passes down through a single family, are examples of:
    15·1 answer
  • Mpf, or mitosis-promoting factor, consists of two important cell-cycle regulatory proteins called _____.
    5·1 answer
  • Fertilization typically occurs while the ovum is passing through the..?
    9·2 answers
  • Which statement is the best summary of the model?
    15·2 answers
  • Clarify why test crosses are used in selective breeding.
    15·1 answer
  • Which choices below allow for primary succession to take place?
    9·1 answer
  • What are the functions of roots
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!