1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gulaghasi [49]
2 years ago
13

9. Vitamins are essential to the survival of organisms because vitamins usually

Biology
2 answers:
Stels [109]2 years ago
3 0

Answer:

It's C

Explanation:

What are coenzymes? Vitamins are essential to the survival of organisms because vitamins usually function as these. What is lipase? Of protease is an enzyme that catalyzes reactions involving proteins, whereas this term can be used for enzymes that catalyze fashions involving fats, oils, and waxes.

BigorU [14]2 years ago
3 0

Answer:

A

Explanation:

substrate.

That's the correct answer

You might be interested in
What are the two ultimate sources of energy for all the living things on Earth?
Stells [14]
The two ultimate sources of energy for all living things on earth is sun light and certain rich compounds like chemotropes.
6 0
4 years ago
Read 2 more answers
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
What is glossities and deficiency
icang [17]
<span>Glossitis is basically swelling/ inflammation of your tongue 
</span><span>Deficiency is basically something wrong, not right, lacking</span>
4 0
4 years ago
What would be the first thing you would do if your clothes caught fire while working in a laboratory
antoniya [11.8K]
I'd say stop, drop, and roll.
7 0
3 years ago
Read 2 more answers
What was healthcare in the ancient world like? How did it provide the foundations for modern healthcare?
SVETLANKA909090 [29]

Answer and explanation;

Health-care in the ancient world was very experimental and under researched. The ancient methods for health care was  affordable only if the best health care was accessible when needed.

The healthcare in the ancient world had a lot to do with herbs and plants because this is what they knew. However they also learned from these and learned about the body and how it works and tried different things.


7 0
3 years ago
Other questions:
  • Dna replication occurs by the addition of nucleotides to the end of the dna molecule. results in the formation of four new dna s
    6·1 answer
  • What is the function of cytoplasm and where is found
    6·2 answers
  • Doctors are seeing an alarming increase in the number of cases of tuberculosis (TB) that is resistant to drugs commonly used to
    12·2 answers
  • Seasonal variations in ocean temperatures can impact the populations of living organisms. If phytoplankton populations grow more
    12·1 answer
  • Which of these statements is correct with respect to osteoclasts?. . A.These cells cause cartilage to build up, thus helping to
    8·2 answers
  • Explain the differences between a point mutation and a frameshift mutation.
    11·1 answer
  • _________ is an agent that kills bacteria. germicide antiseptic bactericidal antiviral
    11·1 answer
  • What enzyme found in saliva breaks chemical bond in stru
    10·1 answer
  • A plant has two alleles for color. the red allele is recessive and is represented by q. the purple allele is dominant, and repre
    5·1 answer
  • Animals capable of moving independent of the ocean currents, by swimming or other means of propulsion, are called_________.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!