1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lakkis [162]
3 years ago
12

A.

Biology
1 answer:
saveliy_v [14]3 years ago
8 0

Answer:D

Explanation:

hope that helped  <3

You might be interested in
Why are indices better than simple measurements for comparing?
o-na [289]
They are better because they are for comparative use for instance hair color to finger nails they both grow but onto separate parts of the body.  

Hope this Helps [:
6 0
3 years ago
Which of these organisms can make glucose?
drek231 [11]

Poison Ivy. They are plants and can make their own food aka Glucose.

6 0
3 years ago
Match each word or phrase to identify whether or not each word or phrase represents a
Alexxandr [17]

The reason for the change in the hands of the chimpanzee include:

  • Crossbreeding between gorillas and chimpanzees( Represents a reason for the change)
  • Mutations in chimpanzee DNA ( Represents a reason for the change)
  • Differences in the ways chimpanzees use their hands ( Doesn't represents a reason for the change)
  • Sexual reproduction ( Doesn't represents a reason for the change)
  • Differences in enhancer sequences( Represents a reason for the change).

<h3>What is mutation?</h3>

Mutation is defined as the alteration in the genetic makeup of a living organism which may occur due to the following:

  • When there is spontaneous break down of deoxyribonucleic acid (DNA).
  • Change in a single nucleotide of the DNA.
  • when there is additions or deletions of nucleotide in a DNA strand.

A change can be noticed in an animal such as Chimpanzee when the following occurs:

Mutations in chimpanzee DNA: This can alter both that anatomy and the physiological features of the organism involved.

Crossbreeding between gorillas and chimpanzees: When there is cross breeding between a chimpanzee and a gorilla, it will lead to a genetic diversity which can be observed as a change in the hands of the chimpanzee.

Learn more about mutation here:

brainly.com/question/29352366

#SPJ1

4 0
1 year ago
After you’ve removed a loopful of broth culture from the culture tube, what’s your next step in preparing a smear?.
Vera_Pavlovna [14]

Given what we know, after you’ve removed a loopful of broth culture from the culture tube you should immediately apply a flame to the open end of the test tube.

<h3>Why would this be the next step?</h3>

Once you have removed the loopful of broth culture from the tube, you should apply a flame to the end of the tube, this is of vital importance. The reason for this is to deny any other contaminants from entering or exiting the culture sample.

Therefore, we can confirm that after you’ve removed a loopful of broth culture from the culture tube you should immediately apply a flame to the open end of the test tube.

To learn more about culture tubes visit:

brainly.com/question/5228823?referrer=searchResults

5 0
2 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Other questions:
  • Survey at least 20 people to find out what traits they have for each of the features below. Tally the numbers for each trait and
    9·1 answer
  • A diet of plant foods supplemented with dairy products and eggs is called
    14·1 answer
  • Electrons that have been excited by light energy absorbed by a chlorophyll molecule Select one: a. are absorbed to the interior
    5·1 answer
  • I need help on number 10 please
    10·2 answers
  • Awncer this question​
    5·1 answer
  • Where does digestion of food begin​
    12·2 answers
  • What kinds of characters can you use to create a data matrix for estimating phylogenetic trees?
    15·1 answer
  • What would normally happen after a new Chinese dynasty came to power?
    6·1 answer
  • Explain how energy moves throughout the system
    10·1 answer
  • Is energy lost by catabolism or anabolism?​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!