1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yawa3891 [41]
3 years ago
12

Proteins are responsibe for

Biology
2 answers:
aleksandr82 [10.1K]3 years ago
5 0

Answer:

B.

Explanation:

Nana76 [90]3 years ago
3 0

Answer:

its a.

Explanation:

im learned protiens in biology like 4 weeks ago.

You might be interested in
Which statement best accounts for the measurements taken in Hawaii in the graph above? ASAP
allochka39001 [22]
Where is the graph ?
5 0
3 years ago
Pea seed color exists as green or yellow. We might say that "yellow" is an example of a (an)_ for seed color
LiRa [457]

Answer:

b. allele

Explanation:

An allele is a variant form of a gene. In this problem, there is one gene (that determines seed color) with two possible alleles (green and yellow).

<u>The other options are wrong because:</u>

The genotype is the combination of alleles an individual has.

The karyotype is an individual's collection of chromosomes, paired and ordered.

A homozygote individual has the same alleles for a particular gene.

A heterozygote individual has different alleles for a particular gene.

6 0
3 years ago
Collection of glands that secrete hormones into the blood which regulate growth, development, and homeostasis.
Kobotan [32]
The answer is the endocrine system.

The brainest answer would be apprenticed.
6 0
3 years ago
All organisms must perform life-sustaining metabolic processes in order to survive.
Alik [6]

Explanation:

  • Unicellular organisms or single celled organisms that are made up only of one cell. Hence the name.
  • Unicellular organisms are further divided into Prokaryotic and Eukaryotic organisms
  • Examples of prokaryotic organisms are bacteria and Eukaryotic are protozoa and unicellular algae, however many eukaryotes are multi cellular as well.
  • These organisms have to carry out life sustaining metabolic processes for their survival.
  • These processes are metabolism, homeostasis and reproduction. Metabolism is important as it involves conversion of food into energy for cellular processes. Homeostasis for maintaining a constant internal physical and chemical conditions and reproduction is by cell division.
  • Multi cellular organisms as the name says unlike unicellular organisms consists of more than one cells.
  • Examples of multi cellular organisms are animals, land plants etc.,
  • Metabolic process in multi cellular organisms is a broad category of processes happening for these organisms which involves chemical reactions and pathways that happen at organismal state, transporting substances between the cells.
6 0
3 years ago
Read 2 more answers
Which of the following does not describe a function of aggressive animal behavior?
nalin [4]

Answer:

C

Explanation:

Aggressive behaviour is a act of violence not without it

5 0
4 years ago
Read 2 more answers
Other questions:
  • Which of the meninges is a delicate connective tissue membrane that clings tightly to the brain like cellophane wrap following i
    9·1 answer
  • Glucose is a six-carbon sugar that diffuses slowly through artificial phospholipid bilayers. The cells lining the small intestin
    14·1 answer
  • Please answer these questions I need help this is my second attempt cause I failed the first one please help me
    14·1 answer
  • Duroc Jersey pigs are typically red, but a sandy variation is also seen. When two different varieties of true-breeding sandy pig
    13·1 answer
  • Cardiac muscle cells are __________. almost totally dependent on anaerobic metabolism mechanically, chemically, and electrically
    6·1 answer
  • Describe the living and nonliving things that define the area or region in which you live. In your area, are there any organisms
    5·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What volume of a 0.25 M solution can be made using 0.55 moles of Ca(OH)2
    11·1 answer
  • Under what circumstances is your instructor required to drop you from your math course?
    10·1 answer
  • Scientists group organisms into three domains: Archaea, Bacteria, and Eukarya. In which domain are animals classified and why?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!