1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Strike441 [17]
3 years ago
7

Why a genetic bottleneck can be an important evolutionary factor for a species

Biology
1 answer:
melisa1 [442]3 years ago
6 0

Answer:

Genetic drift decreases genetic diversity within a population.

Explanation:

Genetic drift decreases genetic diversity within a population. It is a change in allele frequencies due entirely to random chance and is more likely to affect smaller populations than large ones. Population bottlenecks can lead to genetic drift.

You might be interested in
You are part of a small group of humans rocketed at “warp speed” to Planet X, without any books, weapons, or technology. Planet
dybincka [34]

Answer:    

                                                                                                                                                       

                                   

                   

Explanation:

3 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Smog complex is: an atmospheric condition during which a warm layer of air stalls above a cool layer the precipitation of acidic
Eduardwww [97]
A condition associated with smog that causes eye irritation, irritation of the respiratory tract, and chest pains.

Hope this helps!

-Payshence xoxo
5 0
3 years ago
The vertebrate endoskeleton differs from an arthopod's exoskeleton because it
Vlada [557]
The vertebrate endoskeleton is internal while an arthropod's exoskeleton is not
8 0
3 years ago
In 2003 congress passed a prescrition drug benefit as part of which existing health care law
Viefleur [7K]
In 2003 congress passed the Medicare Prescription Drug  Improvement and Modernization Act.  title I. Medicare Prescription Drug Benefit, Section 101. It amends title XVIII, which is the Medicare Act of Social Security to add a new Part D, the voluntary prescription drug benefit plan. It is a voluntary prescription drug program. <span />
7 0
3 years ago
Other questions:
  • In 1850 there was a large snowshoe rabbit population in Manitoba, Canada. Over the years, the winter coloration (the color of th
    15·1 answer
  • What is the advantage for the medical community to use a "universal" language?
    14·1 answer
  • Besides plants what 2 other types of organisms experience plasmolysis
    10·1 answer
  • A microscope reveals one hundred similar cells arranged end to end in a space of 1 milimeter
    5·1 answer
  • The energy in most food comes from synthesis true or false
    6·2 answers
  • 4
    13·1 answer
  • Avanços no conhecimento científico levantaram dúvidas sobre as ideias da criação divina e do surgimento da vida por mecanismos n
    12·1 answer
  • What is the role of the digestive system
    15·2 answers
  • What do the arrows on a food web or food chain indicate?
    13·2 answers
  • How is the food chain related to the web of life?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!