1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady bird [3.3K]
2 years ago
7

What do convection currents mean?

Biology
1 answer:
Dimas [21]2 years ago
7 0

Answer:

Convection currents transfer heat from one place to another by mass motion of a fluid such as water, air or molten rock.

Explanation:

You might be interested in
The most sensitive spot on the entire female genital area is the
wolverine [178]
The most Senistive part of the chest
3 0
3 years ago
What kind of neuron is used in 3 types of gasses
avanturin [10]
Sensory" Neuron
  "Associative Neuron"
  "Motor" Neuron
5 0
3 years ago
Algae Population growth
laiz [17]

Answer:

Algae is an informal term for a large and diverse group of photosynthetic eukaryotic organisms. It is a polyphyletic grouping, including species from multiple distinct clades. Included organisms range from unicellular microalgae, such as Chlorella and the diatoms, to multicellular forms, such as the giant kelp, a large brown alga which may grow up to 50 m in length. Most are aquatic and autotrophic and lack many of the distinct cell and tissue types, such as stomata, xylem and phloem, which are found in land plants.

Explanation:

'Im different"

6 0
3 years ago
An animal can wound a tree by scratching away the bark.. The tree can respond to the wounded many ways. Usually sapped quickly c
Naya [18.7K]

Answer:

the answer is A, cellular reproduction.

Explanation:

because cellular reproduction is a process by which cells duplicate their contents and then divide to yield multiple cells with similar, if not duplicate, contents, basically reforming itself again.

3 0
2 years ago
An organism is made of many cells, cannot move on its own, and absorbs food from its
zlopas [31]
Well all organisms do this! We are left with plant and Fungi.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following technologies has helped to advance modern medicine?
    15·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which factors improve soil fertility? select three answers
    5·2 answers
  • In which condition the substrate have faster diffusion rate
    7·1 answer
  • In _____ the heterozygote's phenotype is somewhat intermediate between the two homozygotes. select one:
    14·1 answer
  • Global climate change
    8·2 answers
  • Cytosine has 30% so thymine would have what percent?
    8·1 answer
  • During photosynthesis plants convert sunlight into what substance to be used for energy
    12·1 answer
  • What happens to cells in multicellular organisms as they continue to divide and increase in size?
    7·2 answers
  • Join <br>https://teams.live.com/meet/95183847411242​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!