Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
Metamorphic rocks form from heat and pressure changing the original or parent rock into a completely new rock. The parent rock can be either sedimentary, igneous, or even another metamorphic rock. The word metamorphic comes from Greek and means To Change Form
Explanation:
Moral altruism
they helped informed only by ethical consideration regardless of any rivalry between the teams. Moral altruism is the highest calling in altruism(helping others selflessly) the team did not consider that if they failed to provide shelter to the other team it would get some advantage over it.
Oceans change the land along the shore, forming tall cliffs and jagged coastlines. "The abrasive nature of seawater causes the rocks to erode over a period of time", the statement explains the type of weathering involved in this process
<u>Explanation:
</u>
The abrasive nature of the sea water of the ocean causes erosion in the rocks which are along the shore. And, this occurs for a period of time causes the formation of the tall cliffs sometimes or to the jagged coastline the other time.
The duration of erosion decides the fate of the cliff or coastline. Erosion of rocks are highly evident in ocean shore line due to the effect of salinity of the sea water. The rocks gets eroded firstly to form jagged coastline which on long exposed erosion forms cliff.
Earthquakes usually happen when a plate underground rubs together.
Hope that helps!
