1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
6

What process is talking place when moving water is carrying away small ppieces of rock

Biology
2 answers:
Mashutka [201]3 years ago
6 0
Erosion
Erosion moves pieces of the Earth.
As pieces of the Earth are broken down by weathering, they are carried away in a process called erosion. Water is a common way that pieces of the Earth are moved to a new location.
jasenka [17]3 years ago
4 0

Answer:

Erosion

Explanation:

You might be interested in
What are the two primary sources of energy for the earth
Lena [83]
The sun and isotopes
3 0
3 years ago
Read 2 more answers
ATP is used for what?
ZanzabumX [31]
ATP is an energy carrier that holds energy after processes like cellular respiration. The body can turn ATP into energy to do processes like physical movement later on. 

Hope this helps :)
6 0
3 years ago
What stage of cell cycle are most of the cells in?
ycow [4]

The interphase is the stage that cells are in the longest.


6 0
3 years ago
What do plants do with the nitrogen they absorb through their roots?
Semmy [17]

Answer:

Explanation:

Plants take nitrogen from the soil by absorption through their roots as amino acids, nitrate ions, nitrite ions, or ammonium ions. ... Plants take nitrogen from the soil by absorption through their roots as amino acids, nitrate ions, nitrite ions, or ammonium ions. Plants do not get their nitrogen directly from the air.

7 0
3 years ago
A semi permeable membrane is placed between two solutions the membrane is only permeable to water on the right side is a 10% sal
ddd [48]

Most water molecular move from x to y decreasing the concentration gradient of sucrose. The solution will always move down the concentration gradient.

This means the water always move from this is more water to where there is less water.

Therefore, water will move from a hypotonic solution to the hypertonic solution.

hope it helps you.

Mark me as brainlist..

8 0
3 years ago
Other questions:
  • Humus represents _____ of the soil composition to 5% b) 60% c) 25% d) 15% e) 50%
    10·1 answer
  • How do scientists gather information about the natural world
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A microbiologist wants to study the virus particles from a urine sample, but not any bacteria that might be present. How can the
    9·1 answer
  • look below for my questions, i really need help and school is really affecting my mental health but this site keeps saying that
    12·2 answers
  • How does our DNA cause us to have physical traits?
    5·1 answer
  • Can somebody help me .
    9·1 answer
  • 5 sentences each help me please
    11·1 answer
  • Do you think any of the mutations could have been harmful for the beetles’ survival? Explain your answer.
    12·2 answers
  • An organism obtains energy by the reaction of hydrogen gas (H2) and oxygen gas (O2) to produce water. This is an example of quiz
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!