This means to come up with your own hypothesis or assumptions of something because there is some missing information or not clearly stated.
Answer:
After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is
Explanation:
1. AACGTACGATCGATGCACATGCATGGCTACGC
Complementary strand
TTGCATGCTAGCTACGTGTACGTACCGATGCG
Protein encode: NVRSMHMHGY
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
Complementary strand
GGGCCCATACGTACATGCATGCAGCATATAGC
Protein encode: PGYACTYVVY
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
Complementary strand
GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA
Protein encode: RDRAIDECLV
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
Complementary strand
AATTTGCTCGACGATCGATAAAAATTTTGGGGC
Protein encode: LNELLAIFKTP
Answer:
The central dogma of molecular biology best describes the relationship between proteins and nucleic acid.
Explanation:
Nucleic acid such as DNA is the repository of genetic information in most organism.
The genetic information stored in DNA is Transferred to RNA by transcription which deals with the the production of mRNA from DNA.
The mRNA then undergo translation to transfer its own own genetic information in form of codons to specify amino acids of a protein molecule.
Thus the Central dogma of molecular biology relates proteins and nucleic acids.
Limestone deposits can help researchers learn about what the area was like thousands of years ago as Limestone can contain fossilized plants and animals.
Explanation:
- Limestone often contains fossils of shelled sea creatures. Entire reef formations and communities of organisms are found preserved in limestone.
- The types of fossils found in limestone include coral, algae, clams, brachiopods, bryozoa and crinoids.
- Limestone is a sedimentary rock made almost entirely of fossils.
- Fossils are the remains of ancient plants and animals, like an imprint in a rock or actual bones and shells that have turned into rock. Fossils are found in sedimentary rocks and hold the clues to life on Earth long ago.
- Limestone is composed of the mineral calcite; calcium carbonate. It often has variable amounts of silica in it, as well as varying amounts of clay, silt, and sand. Limestone rocks fall under the category of sedimentary rocks that are made from mineral calcite.
Its B clearing and farming. Because if you think of it when someone clears trees and bushes they most likely won't come back.
