1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Phoenix [80]
2 years ago
15

Megan observes four cells under a microscope and makes sketches of them as shown. Identify whether the cells are prokaryotic or

eukaryotic.
Biology
1 answer:
ioda2 years ago
3 0
Prokaryotes don’t have nucleus
Eukaryotic have nucleus
You might be interested in
Why is transpiration a necessary evil
Leto [7]

Answer:

for movement of water through an organism

Explanation:

transpiration is the process by which water is transported from the roots to the leaves of a plant through the xylem

8 0
3 years ago
Viewed from ecliptic north, what is the direction of rotation (clockwise or counterclockwise) of Venus around its axis? Of Earth
denis23 [38]
<span>If you were to look down at the plane of the solar system from its 'north pole' you would see the planets orbiting the Sun counter clockwise, and rotating on their axis counterclockwise. Except for Venus. Venus would be rotating clockwise as it orbited the Sun counterclockwise. Venus is not alone. The axis of Uranus is inclined so far towards the plane of the solar system that it almost rolls on its side as it orbits the Sun.</span>
4 0
3 years ago
Read 2 more answers
A scientist is studying a cell and can clearly see that it has ribosomes and mitochondria. Which statement best describes how th
ruslelena [56]

Answer:

The cell is eukaryotic because it contains mitochondria.

nucleus

Explanation:

8 0
2 years ago
Which of the following molecules are not required to express a gene in eukaryotic cells?
slava [35]

Answer:

Repressor protein

Explanation:

Repressor is a protein that binds to deoxyribonucleic acid(DNA) or ribonucleic acid(RNA) it inhibits the expression of one or more genes which is done by binding to the associated silencers.

A DNA binding repressor works by blocking the attachment of RNA polymerase an enzyme that enhance transcription to the promoter, thus preventing genes from been transcribed into messenger RNA.

An RNA binding repressor binds to the messenger RNA and prevents translation of the bases on the messenger RNA into protein. The blocking of expression is called repression.

4 0
3 years ago
Based on the reading, meatpacking plants were most concerned about:
alina1380 [7]
The meatpacking plants were mainly concerned about making money. 
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which conclusion can be made from the data in the table? The higher the temperature, the fewer chirps there will be in 10 second
    5·2 answers
  • Why do you think premenopausal women need more iron than<br> men of the same age?
    8·1 answer
  • Why are all of the organs in the alimentary canal important in digesting food? As food passes through each organ, different horm
    8·2 answers
  • Which statement summarizes the law of independent assortment?
    13·1 answer
  • Could someone please help me with question 21
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • 1. Which sentence about galaxies provides evidence of universe expansion that supports the Big Bang Theory?
    7·2 answers
  • What were the independent, dependent, and control variables in your investigation? Describe the variables for the simulation wit
    15·1 answer
  • Explain the pathway of reflex arc and all the components involved from the time the patellar tendon.
    11·1 answer
  • Which brain structure relays information from the eyes to the visual cortex?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!