1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Phoenix [80]
3 years ago
15

Megan observes four cells under a microscope and makes sketches of them as shown. Identify whether the cells are prokaryotic or

eukaryotic.
Biology
1 answer:
ioda3 years ago
3 0
Prokaryotes don’t have nucleus
Eukaryotic have nucleus
You might be interested in
As you look at the general trends of the graph, what happens to the biodiversity when a mass extinction happens? Why?
spin [16.1K]

Explanation:

As lineages invade different niches and become isolated from one another, they split, regenerating some of the diversity that was wiped out by the mass extinction. The upshot of all these processes is that mass extinctions tend to be followed by periods of rapid diversification and adaptive radiation.

Let me know if this helped! xoxo

5 0
3 years ago
Glossopteris is an ancient, extinct species of what?
baherus [9]
<span>Glossopteris is an ancient and extinct species of seed ferns known as Glossopteridales. They came from the Greek word glossa, which means “tongue,” because its leaves were tongue-shaped. It is actually the largest and best-known genus of seed ferns that rose in the Southern Hemisphere during the beginning of the Permian Period (298.9 million years ago).</span>
6 0
3 years ago
How many variables can a scientist change during a scientific investigation?
Nastasia [14]

Answer:

Three

Explanation:

6 0
3 years ago
Read 2 more answers
Why do people with albinism lack melanin
Luden [163]
Albinism is a disease in which a person has partial or complete loss of pigmentation (coloring) of the skin<span>, </span>eyes<span> and </span>hair<span>. </span>
7 0
3 years ago
What is BHT for freshness considered?
Lena [83]

Answer:

E

Explanation:

In meats , chips , edible facts, dehydrates foods, baked goods contain BHT.BHT mean preservative ingredients..

Hope its help ya

* Rasp25tashya*...

3 0
3 years ago
Other questions:
  • A map show the surface features of an area is called an_______ map
    9·1 answer
  • A client has been diagnosed with otosclerosis. the nurse explains to the client that this is a common cause of hearing impairmen
    13·1 answer
  • When you touch something hot, a neuron in your finger senses the temperature. Which best describes the first reaction the neuron
    6·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Waste-to-energy plants convert trash into energy. The energy produced is known as ____?
    10·1 answer
  • Carnivore that feeds on primary consumers
    9·1 answer
  • What is the ABO blood classification based on?
    13·2 answers
  • What is a gene?
    5·2 answers
  • I need this asap: The cells that lie between dermal and vascular tissue make up what kind of tissue?
    7·1 answer
  • A researcher is studying the plants and animals in a particular biome. The observations include ferns, large woody vines, monkey
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!