1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
2 years ago
8

Do plants need carbohydrates? Why or why not?

Biology
1 answer:
Aleksandr-060686 [28]2 years ago
7 0

Answer:

<em>Aside</em><em> </em><em>from </em><em>using </em><em>complex </em><em>carbohydrates</em><em> </em><em>to </em><em>create</em><em> </em><em>the </em><em>plant's </em><em>structure,</em><em> </em><em>plants </em><em>store </em><em>carbohydrates</em><em> </em><em>or </em><em>use </em><em>them </em><em>for </em><em>energy</em><em> </em><em>to </em><em>grow.</em>

You might be interested in
Explain how drinking through a straw illustrates fluid flowing from high-pressure to low-pressure​
Vilka [71]

Drinking through a straw shows fluid flowing from high pressure to low pressure in 2 ways. The first is how it shows high pressure as you stuck on the straw. This increases the pressure and brings the fluid to your mouth. If this pressure is kept you can successfully pick up the straw filled with water and have none come out. This demonstrates low pressure when you stop ducking and the fluid falls back down the straw into your cup.

7 0
2 years ago
The age of the earth is inferred from the
Marina CMI [18]

The age of the earth can however be derived from prior knowledge of the age of the Canyon Diablo meteorite.

<h3>What is Age?</h3>

This is defined as the length of time during which a being or thing has existed.

The fragment of the Canyon Diablo meteorite determined the elements that formed as radioactive uranium decayed over billions of years.

Read more about Age here brainly.com/question/24774411

3 0
2 years ago
How do temperature humidity and pressure vary within an air mass​
Assoli18 [71]

A. Temperature, humidity, and pressure are basically the same all through an air mass.

B. Temperature at the border of an air mass is always higher than in the middle.

3 0
3 years ago
Read 2 more answers
4. A plant can have yellow (Y) or green (y) leaves. It can also have smooth (S) or rough (s) seeds.?
navik [9.2K]
A.) The phenotype is yellow, smooth 

This is because (Y) yellow is dominant over (y) green. If an organism has a trait that is dominant, it will show up with no exceptions (YY, Yy, Ss, SS). Recessive traits on the other hand will only show up if both the maternal (Mom) and the paternal (Dad) copy given are both recessive (yy or ss).

b.) It depends on what the YySs plant is paired with. Will it be paired with another YySs, with YYSS, yyss, YySS, yySS, YYss...? For example, if it is paired with another YySs, make a punnett square. 
4 0
3 years ago
Parkinson’s disease is a progressive disorder that is caused by degeneration of nerve cells in the part of the brain called the
madreJ [45]

Answer:

The Parkinson´s prevalence is 60,000 diagnosed cases per year, with an estimate of 1-1.5 million Americans ill,  and the incidence is 18,000 deaths (2003), affecting mostly after the age of 55, but sometimes 30 and 40.

Explanation:

The common symptoms include  involuntary tremor in hands, arms, legs and jaw , muscle stiffness arms, shoulders or neck , gradual loss of movement which often leads to decreased mental skills, changes in voice and facial expression as blinking, swallowing and drooling , stooped posture, unsteady balance  and dementia.

Unfortunately the regular diagnosis methods such as  X-ray or blood test, are not suitable to confirm this disease, only conventional methods such as  two of the three symptoms found in the patient, no more neurological signs found, exclude the tranquilizer medications, head trauma or stroke  patients´usage and try levodopa, dopamine agonists, COMT inhibitors, selegiline, anticholinergic medications or amantadine, which are Parkinson's medication, only to relieve the symptoms, by stimulating the remaining cells in the substantia nigra to increase the levels of dopamine or by decreasing the acetylcholine produced.

Procedures such as surgery, pallidotomy, thalamotomy, and deep brain stimulation are also available procedures to help Parkinson´s extreme symptoms.

On going experimental research  on embryonic stem cells, although political and ethical controversial, might enable scientists to produce dopamine neurons in the laboratory for transplantation into humans offering hope for Parkinson's cure in the future.

5 0
2 years ago
Other questions:
  • Sam’s teacher is trying to model the day/night cycle on Earth. One student holds a large yellow ball to represent the Sun. Anoth
    9·2 answers
  • The name of the receptor region containing hair cells involved in detecting static equilibrium is
    6·1 answer
  • The outer planets-jupiter,Saturn,Uranus,and Neptune-are made up of which gases ?
    7·1 answer
  • Which of the following would be bigger than the others? a polymer b glucose c amino acid d monomer
    7·1 answer
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • What happens to sedimentary rock after pressure occurs more layer
    15·2 answers
  • What drives global thermohaline (conveyor belt) circulation?
    5·2 answers
  • URGENTTTT!!<br>does a fire respond to its environment?​
    6·1 answer
  • What is the representative organism for a sponge?
    13·1 answer
  • Hows y'alls day been
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!