1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksley [76]
3 years ago
12

A couple with a newborn baby is troubled that the child does not resemble either of them. suspecting that a mix-up occurred at t

he hospital, they check the blood type of the infant and find that it is type o. as the father is type a and the mother type b, they conclude that a mix-up must have occurred.
Biology
1 answer:
BigorU [14]3 years ago
7 0
The result of this would greatly depend on the genotype of the parents. If either the father is homozygous Type A and the mother is homozygous Type B, then yes, a mix up has occurred because the probability of having an offspring with the blood type O would be zero. But if both of them are heterozygous, then having a child with type O will be possible with a 25% probability. 
You might be interested in
Which statement correctly describes the nucleus of the atom?
lidiya [134]

Answer:

D. the nucleus contains the protons and neutrons which takes up most of the mass of the atom

Explanation:

5 0
4 years ago
Read 2 more answers
What is the overall equation for photosynthesis?
shusha [124]
H20+Sunlight+CO2=C6H12O6
^                          ^         ^
Water   Carbon Dioxide  Glucose 
3 0
3 years ago
Read 2 more answers
The plasma membrane is composed of a phospholipid bilayer with embedded proteins. What is one of the functions of the embedded p
sergiy2304 [10]

The embedded proteins <u>allow specific substances to flow into the cell</u>.The phospholipid bilayer forms a stable barrier between two aqueous compartment.They embedded proteins carry the selective transportation of molecules and ensure their is cell to cell recognition.

5 0
3 years ago
Read 2 more answers
How do the various part of the body work together when we eat something
gulaghasi [49]

Answer:

Your digestive system absorbs water and nutrients from the food you eat. Your circulatory system carries oxygen, water, and nutrients to cells throughout your body. Wastes from the cells are eliminated by your respiratory system, your excretory system, and your skin.

Explanation:

6 0
3 years ago
Some bacteria viruses parasites and fungi can cause an illness. these are known as?
yawa3891 [41]

Infectious diseases are disorders caused by organisms — such as bacteria, viruses, fungi or parasites.

<h3>What are viruses bacteria and parasites?</h3>

Viruses, bacteria, and parasites live organisms that are found all around us. they're in water and soil. they're on the surfaces of foods that we eat. they're also on surfaces that we touch, like Counter top in the bathroom or kitchen. Some bacteria sleep in and on our bodies and don't cause problems.

<h3>Which are infectious diseases?</h3>

The flu, measles, HIV, streptococcal sore throat , COVID-19 and salmonella are all samples of infectious diseases. Cancer, diabetes, congestive coronary failure and Alzheimer's disease are all examples of noninfectious diseases.

What are the causes of disease?

Similarly, diseases are caused by different microorganisms and may be classified as diseases caused by bacteria, fungi, viruses etc. Some diseases also are caused by multicellular organisms such as worms.

Learn more about infectious diseases :

brainly.com/question/14083398

#SPJ4

5 0
2 years ago
Other questions:
  • Water vapor in the air can be high or low, depending on your location. Water vapor is a _____.
    13·2 answers
  • All of the following are steps in the formation of a fossil except:
    12·1 answer
  • Cooking a cheeseburger physical or chemical
    6·2 answers
  • 1. Describe how water moves through the water cycle.
    10·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which structure could a scientist look for in a plant that would identify it as a club moss rather than a liverwort?
    15·2 answers
  • It is the sequence of nucleotides in our DNA that makes each one of us unique. Specifically, it is the sequence of nucleotides i
    6·2 answers
  • Which is an example of mechanical digestion that occurs in the human digestive system?
    6·1 answer
  • Which of the following means 'returning<br> the land to its original condition'?
    13·1 answer
  • How many electrons does this isotope of titanium have?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!