1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korvikt [17]
3 years ago
14

Hemophilia a has been diagnosed in a young boy. he has inherited this defective gene from

Biology
1 answer:
Montano1993 [528]3 years ago
6 0
The mother because it is an x-linked trait and the boy received a y from his father so therefore he could only get the x from his mother.
You might be interested in
Which of the following statements about biodiversity is true?
V125BC [204]
C. Changes to biodiversity can positively and negatively affect an ecosystem.
5 0
3 years ago
Read 2 more answers
If the global warming trend continues and permafrost under the tundra melts, what biome would you predict would replace it?
Vladimir [108]

Answer: If the global warming trend continues and permafrost under the tundra melts, the biome that would you predict would replace it is:

Boreal Forest

Explanation: A boreal forest is a vegetation composed primarily of cone-bearing needle-leaved or scale-leaved evergreen trees, found in northern circumpolar forested regions characterized by long winters and moderate to high annual precipitation.

4 0
3 years ago
Read 2 more answers
A type of asexual reproduction through which all the genetic information is copied and a new organism is produced is called
3241004551 [841]

Answer:

Budding

Explanation:

I'm so sorry. I originally was thinking cells but then realized it was talking about a different situation. This is the answer.

3 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
What might be one possible reason for the greater fluctuations in the blue crab population?
Ierofanga [76]

Blue Carb which scientifically is known as “<span>Callinectes sapidus” is a type of vertebrates. </span>A possible reason for the fluctuation in their population can be the eutrophic dead zones in the Chesapeake Bay which naturally cases low levels of oxygen dissolving into the Bay leading to fluctuation of Blue crab population.

<span>Another reason also can be the shorter life span of blue crab, its average life span recorded is one to three years which is very short in comparison to striped bass, although some blue crabs are caught after being tagged at the age of 6 to 8 years as well.</span>

6 0
4 years ago
Other questions:
  • A tiny rocky island in the South Pacific is home to a very small food chain. Coconut palms grow on the island and drop coconuts.
    9·1 answer
  • Living organisms respond to changes in environmental conditions such as temperature. Which series lists the correct order in whi
    13·2 answers
  • Why can’t you drink salt water?
    8·1 answer
  • How do guard cells work in leaves??
    10·1 answer
  • A pair of amino acids is chemically bonded is called as,
    6·1 answer
  • Survival of at least a few members of a population after a major environmental change is most dependent on
    11·1 answer
  • Look at page 4 of the document, question 3, gathering data. This is for a science gizmo. You just have to do the table and pls h
    5·1 answer
  • What makes a plant a plant?
    8·2 answers
  • 2 Choose from the following words to fill in the blanks of the steps in DNA replication. Each one may be used only once. identic
    10·1 answer
  • Opp- Nevermind I found the answer = w =
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!