1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kay [80]
2 years ago
9

Name: ____________________________________________________ Date: ____________________________ Hour: __________

Biology
1 answer:
Rudiy272 years ago
8 0

Answer:

skjdfjs fsf wsfwsef s fe w feqw f w fwe f w fe we f ew rr ge rf e e  r w t r3g  efvg grr sg  gr

Explanation:

You might be interested in
Which type of immune system cell engulfs pathogens and other foreign particles?
FromTheMoon [43]

A macrophage is a large phagocytic cell that engulfs foreign particles and pathogens. So Macrophage.

Hope this help! :)

6 0
1 year ago
We know that animals can be separated into two big groups: vertebrates and invertebrates. An example of each would be a horse an
Alika [10]

The answer is C since heterotroph means they don't have a way of making food

3 0
3 years ago
Read 2 more answers
When energy is changed from one form to another with very little loss, the process is said to be
alexgriva [62]

Answer:

A

Explanation:

Efficiently

3 0
2 years ago
Which statement describes the proper procedure for identifying an organism by using a dichotomous key?
Zinaida [17]

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

5 0
3 years ago
6. How might dams on a river<br> affect the amount of sand on<br> a beach?
jeka94

Answer:

In addition to storing water, the reservoirs behind each of these 500 barriers also trap sand that used to be carried to the shoreline. Dams now withhold sediment from about 16,000 square miles of the state's coastal watersheds and have reduced the flow of sand by 25%, or about 3.6 million cubic yards each year.

Explanation:

5 0
3 years ago
Other questions:
  • What are two possible uses of genetic engineering
    13·1 answer
  • In the following experiment, what is the independent variable? Dr. Honeydew would like to test the effect of chlorine on Beaker'
    5·1 answer
  • Examine the data table, which shows data for quadrat #18.
    5·2 answers
  • Positively charged sodium ions transport electrical impulses in the nervous system. Which subatomic particle does sodium lose to
    7·1 answer
  • What would happen if DNA was not replicated prior<br> to cell division?
    6·1 answer
  • DNA replication requires all of the following EXCEPT: a template, that is, a strand or strands to be copied. the monomers that a
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • There was a massive earthquake that separated a large population into two groups on opposite sides of a valley. If members of th
    7·1 answer
  • Using the rules for selecting symbols for the elements, which of the following could
    9·1 answer
  • QUESTION 11
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!