1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhenek [66]
3 years ago
11

What are three ways erosion and weathering are the same

Biology
1 answer:
Stells [14]3 years ago
8 0

Answer:

The primary difference between weathering and erosion is that weathering occurs in place whereas erosion involves movement to a new location. Both are caused by similar factors of wind, water, ice, temperature, and even biological action. They can also occur together.

Explanation:

You might be interested in
Which chemical bond most likely stores the most energy?
Lunna [17]
I think the anser is d that what i think Is
5 0
3 years ago
Please answer question.
eimsori [14]

Answer:

Yes

Explanation:

Because they are being helpful so that te other wolfs don't get attacked over the food.

5 0
3 years ago
How is solar power used for heating?
Kipish [7]

Answer:

B. the sun heats water stored...

Explanation:

3 0
3 years ago
Read 2 more answers
PLZ HELP!!!! I'LL GIVE BRAILLIEST!!!<br><br><br> How does a tobacco mosaic virus reproduce???
Dominik [7]

Tobacco mosaic virus (TMV) is a simple rod-shaped helical virus that contains single stranded RNA situated at its middle and is surrounded by a protein coat called capsid. After tobacco mosaic virus enters its infected host cells through mechanical inoculation, it removes its capsid to release its single stranded viral nucleic acid which is then transported into the nucleolus. The single stranded viral RNA actuates the production of specific enzymes (RNA polymerases) and it also produces another RNA strand (replicative RNA). The new viral-RNAs are transported from the nucleus into the cytoplasm and functions as messenger-RNAs (mRNAs). Each mRNA, ribosomes, and t-RNA, of the infected host cell all controls the production of protein subunits (capsomeres). After the production of the preferred capsomeres, the new viral-RNAs arrange the capsomeres around it which lead to the production of a complete virus particle (virion). The viruses then migrate from one cell to another. Hence, creating organized infection.

3 0
3 years ago
The minerals in an ingeous rock come from the
shusha [124]

Answer:

volcanic eruption, hardened lava, mantle

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • This morning in class, oya learned about the way neighboring neurons are involved in the firing of an individual neuron. If enou
    15·1 answer
  • BRAINLIESTTT ASAP!
    12·1 answer
  • Twin studies have confirmed that genetic and environmental factors operate __________ to guide development.
    10·1 answer
  • Air pollution is caused by  A. the sun.  B. heavy rainfall.  C. natural events and human activities.  D. human activities bu
    14·2 answers
  • You have an ecosystem with the following organisms: birds, fruit trees, tigers, and monkeys. Which list would best describe the
    11·2 answers
  • This image shows the RBCs of a person with sickle cell anemia, an inherited condition. What effects could the shape of these cel
    15·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of the following is a direct interspecific interaction?
    7·1 answer
  • When the Hubble Space telescope was first launched, it was the most advanced technology of its kind. Astronomers and astrophysic
    11·1 answer
  • Among us code:<br> SRCSMF
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!