1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
polet [3.4K]
3 years ago
10

How do Herbivores move energy through a eco-system?

Biology
1 answer:
koban [17]3 years ago
8 0

Answer:

A herbivore is an animal that gets its energy from eating plants, and only plants.

You might be interested in
Which statement best describes cancer cells?
zvonat [6]

Answer: They are not regulated by contact inhibition.

Explanation:

Contact inhibition is a form of controlling cells. Cancer doesn't have contact inhibition, which is one of the reasons why it spirals out of place so easily.

3 0
3 years ago
Read 2 more answers
What has caused the greenhouse effect to become imbalanced? *
Alekssandra [29.7K]
Burning fussil fuels
4 0
3 years ago
Read 2 more answers
Which type of point mutations can cause the MOST change in the amino acids?
kirill [66]
2. Insertion
would cause a frame shift in the polypeptide chain and potentially cause a stop codon.
6 0
3 years ago
The infections that people get while they are in hospitals are commonly resistant to multiple drugs. What is a reason for the in
Harman [31]

Answer: The reason for the increased number of drug-resistant bacteria being found in hospitals is due to MISUSE and OVERUSE of antibiotics.

Explanation:

Antibiotics is a type of drug that attacks bacteria microorganisms either by killing or eliminating the bacteria (that is, bactericidal) or by preventing further growth of the bacteria (that is, bacteriostatic). Antibiotics should be taken properly while being used to treat any diseases condition to prevent drug resistance by the bacteria from occurring.

The reason for the increased number of drug-resistant bacteria being found in hospitals is due to MISUSE and OVERUSE of antibiotics. This causes the bacteria to change the way they respond to these medicines making them become antibiotic resistance. When they infect an individual, the infections they cause are harder to treat than those caused by non-resistant bacteria.

3 0
3 years ago
What is the role of the enzyme diaphorase
Kruka [31]

The role of the diaphorase enzymes is to transfer hydrogen ions between donor and acceptor molecules.

8 0
2 years ago
Other questions:
  • The cell cycle of a eukaryotic cell describes the birth, growth, reproduction, amd the death of a cell. true or false
    14·1 answer
  • True or false? the limbic system in the brain helps to regulate emotional activities and memory.
    12·1 answer
  • What would you have to do if you suspected that your plates were contaminated?
    8·1 answer
  • Studying embryology help scientists understand
    13·2 answers
  • Minerals:
    15·1 answer
  • Animals, like other life-forms, evolved in the ocean. What made water a better nursery than land for the evolution of animals?​
    8·2 answers
  • What does a scientific theory include
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • *Ways we turn hydropower into energy we can use:
    12·2 answers
  • Explain why we have different seasons.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!