1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Otrada [13]
3 years ago
14

Which process is occurring in this photograph of a glacier? please and thanks!

Biology
2 answers:
zheka24 [161]3 years ago
7 0

Answer:

plucking

Explanation:

telo118 [61]3 years ago
5 0

Answer:

The correct answer is option A, that is, plucking.

Explanation:

Quarrying also considered as plucking refers to a glacial process, which is accountable for the transportation and erosion of the single fragments of bedrock mainly the large joint blocks. With the movement of the glacier down in a valley, the friction makes the basal ice of the glacier to infiltrate and melt the joints in the bedrock.

You might be interested in
One of the nutrient cycles moves from an atmospheric gaseous form to the soil through both abiotic and biotic processes, moves t
Triss [41]

Answer:A) Nitrogen

Explanation: nitrogen cycle ensures the movement of nutrients through the biosphere.it ensures that nitrogen is constantly reused and made available.

Nitrogen gas is available in the atmosphere but plants and animals cannot use it in that form.it must be converted to compounds such as ammonia or nitrate.

It is gotten from the atmosphere during rainfalls where it Is broken down and combines with oxygen to from nitrogen peroxide.

Nitrogen can also be fixated into ammonia by saprophytic bacteria.

Also when plants die their body tissues are broken down to form ammonia.ammonia can be oxidized into nitrates and nitrite which plants can use.

Nitrites can be released back into the atmosphere through denitrifying bacteria and the cycle continues.

3 0
3 years ago
Proto‑oncogenes are genes that have the potential to become oncogenes through either mutation or an increase in expression. Clas
algol [13]

Answer:

<u>Proto-oncogenes</u>

  • These genes code for protein that normally promote cell division
  • Mutations that increase activity of these genes may lead to cancer

<u>Tumor suppressor genes</u>

  • These genes code for protein that normally prevent uncontrolled cell division
  • Some products of these genes normally function in repairing damaged DNA
  • Mutation that decrease activity of these genes may lead to cancer.

Explanation:

<em>Proto-oncogenes</em> are group of genes that ordinarily help cells develop. At the point when a proto-oncogene mutates or there are such a large number of duplicates of it, it turns into a "terrible" quality that can turn out to be forever turned on or activated when it shouldn't be. At the point when this occurs, the cell becomes wild, which can prompt malignant growth. This terrible quality is called an oncogene.

Tumor suppressor genes are normal gene that hinder cell division, fix DNA missteps, or tell cell when to undergo apoptosis (die). At the point when tumor suppressor gene don't work appropriately or inactivated, cells can develop uncontrollable growth, that ultimately lead to cancer.

7 0
3 years ago
Wildlife biologists treated a pool with a chemical to reduce the amount of algae. A(t)=35t-360t+1050
fiasKO [112]

Answer:

-325 + 1050

Explanation: No need to

4 0
3 years ago
Which part of a rock will undergo rusting?
Lisa [10]
Iron, oxygen and water react with the iron creating a substance known to us as rust.

Hope this helps.
6 0
3 years ago
Erythrocytes live for a maximum of.......days whereas platelets live for ....... days
Tomtit [17]

Answer:

120 \:  days;10  \: days.

Explanation:

Thanks!!!!!

5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • When ATP is used in the cell it becomes ___
    5·1 answer
  • Using phase contrast microscopy on a wet mount of live cells, you observe motile bacilli moving rapidly and randomly through the
    13·1 answer
  • Which of the following is not a characteristic of all living things?
    13·1 answer
  • Explain why a species of barnacles semibalanus balanoides is dominant in areas that are usually under water and another species
    7·1 answer
  • Do you have to take piercings out for x rays
    12·1 answer
  • What are some of the ways physical properties of stars ?
    8·1 answer
  • Many populations in a specific area or region at a certain time make up a O Community O Niche O Ecosystem O Population​
    13·1 answer
  • Create a personal plan of preventative health and dental management. What steps can you take to maintain your health and wellnes
    14·2 answers
  • What period did the earliest amphibians appear?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!