1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
3 years ago
11

PLEASE HELP!!!!!!! PEASEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

Biology
1 answer:
FinnZ [79.3K]3 years ago
5 0

Answer:

it's not clear

and not seeing the system clearly

You might be interested in
Which cellular process is described by the chemical equation below?
lbvjy [14]
That would be cellular respiration.
6 0
3 years ago
Read 2 more answers
As a rock musician who has experienced prolonged exposure to high-amplitude sounds, rodney is beginning to lose his hearing. it
vaieri [72.5K]

Hello there

the answer to your question is

cochlea

Hopefully this helps

Best Regards Queen Z

thank you

6 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
The prokaryotes most likely to be found living in extreme environments such as salt ponds or hot springs are _____. the prokaryo
PtichkaEL [24]

Answer:

archaeabacteria ( context clues can often give the answer :)

4 0
3 years ago
What type of tissue would be found in the epidermis and form the lining of internal organs such as the intestines
madreJ [45]

Epidermal tissue as this is what makes up the lining  

4 0
3 years ago
Other questions:
  • The building blocks of nucleic acids are ________.
    9·1 answer
  • What is the function of tendril? How is the tendril of pea different from that of pumpkin?
    9·1 answer
  • Which is the second smallest level of organization? W X Y Z
    15·1 answer
  • The site where the ureters enter the bladder is termed the _____ junction.
    7·1 answer
  • Wegener named the supercontinent pangaea, which means _____. "all lands" "large rock" "only land" "all seas"
    15·2 answers
  • The graph below shows the decay of a radioactive isotope. What is the half-life of the isotope?
    6·2 answers
  • 10 points plus brainliest! please help!!
    9·2 answers
  • Rhizobium bacteria obtain moisture from: A.protiens B.nodules c.legumes D.air
    6·2 answers
  • What is "twinkling"? (in telescopes) a. Flashing of quickly revolving starts b. Distortion of light in the very large mirrors of
    6·1 answer
  • The only group of animals that begin their lives in the water breathing with gills and as adults can live on land breathing with
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!