1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sladkih [1.3K]
2 years ago
6

I need help asap with this

Biology
1 answer:
Fiesta28 [93]2 years ago
4 0

Answer:

It's b

Explanation:

Any other answer is incest lol

You might be interested in
What effect on the body does a lack of insulin have?
ludmilkaskok [199]
Insulin is such a vital secretion of the pancreas in the human body that without it, our body would not function normally. It is responsible for breaking down the food we eat and converting it to energy and then storing that energy. Lack of insulin means that the pancreas are not producing insulin which leads to diabetes. That means that there is a concentration of glucose in the blood rather than being distributed to cells to carry out functions. This can lead to kidney failures,  nerve damaging stomach problems and problems in the eyes.
7 0
3 years ago
Which is a characteristic of a virus, but NOT a bacterium? A) capsid Eliminate B) causes illness C) damages the cells in a body
Anni [7]

Answer:

you are right a

Explanation:

5 0
4 years ago
Which of the following is the responsibility of a boat operator?
prisoha [69]
Where’s the following
4 0
3 years ago
Whereas superficial flexors in the anterior compartment of the forearm originate from the _____ epicondyle of the humerus, the s
ASHA 777 [7]

Answer:

Whereas superficial flexors in the anterior compartment of the forearm originate from the medial epicondyle of the humerus, the superficial extensors in the posterior compartment of the forearm originate from the lateral epicondyle of the humerus.

Explanation:

The forearm has 2 compartments: an anterior compartment responsible for the flexion of the wrist, and a posterior compartment with the function to extend the wrist.

The superficial muscles in the anterior compartment arise from the common flexor tendon that originates from the medial epicondyle of the humerus. This compartment is mostly innervated by the median nerve.

The superficial muscles in the posterior compartment originate from the lateral epicondyle of the humerus and are innervated by the radial nerve.

The ulnar nerve innervates the flexor carpi ulnaris and flexor digitorum profundus in the forearm.

6 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • If wolf-like morphology occurs in the animals that share it because this body form produces a very efficient predator, the morph
    15·1 answer
  • What is significant about areas in the dna that contain repeated segments?
    14·1 answer
  • Which of the following is NOT a type of fungus
    8·1 answer
  • What is one factor that affects the explosivity of magma
    8·2 answers
  • Why can't all mixtures be classified as solutions?
    14·1 answer
  • Let's suppose you were interested in developing drugs to prevent epigenetic changes that may contribute to cancer. What cellular
    10·1 answer
  • In which region of the United States is new Mexico located in
    7·2 answers
  • Phosphorus is?
    12·1 answer
  • What is true about the relationship of adenine and thymine
    13·1 answer
  • Which of the following statements describes pepsin
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!