1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crank
3 years ago
11

Put the steps into the correct order to describe iron deficiency anemia,

Biology
1 answer:
ollegr [7]3 years ago
6 0

How Is Iron-Deficiency Anemia Diagnosed?

Iron-deficiency anemia is diagnosed by blood tests that should include a complete blood count (CBC). Additional tests may be ordered to evaluate the levels of serum ferritin, iron, total iron-binding capacity, and/or transferrin.

Anemia occurs when your blood doesn't have enough red blood cells. This can happen if: Your body doesn't make enough red blood cells. Bleeding causes you to lose red blood cells more quickly than they can be replaced. Your body destroys red blood cells.

Stages

Stage 1: Diminished total-body iron content. This stage is identified by a reduction in serum ferritin

Stage 2: Reduced red blood cell formation

Stage 3: Iron deficiency anemia.

You might be interested in
What organelles are in a white blood cell<br> ?
nika2105 [10]
Lysosomes are found in white blood cells and is what provides the enzymes need to consume the foreign object that it finds in the body. 
7 0
3 years ago
What do the rib muscles and diaphragm have in common?
Hatshy [7]

Answer:

Both are breathing muscles

Explanation:

When rib muscles and the diaphragm contract they increase the volume of the chest cavity, increasing the air pressure outside the body, causing air to rush into the lungs to fill the vacuum created by the increase in volume.

3 0
2 years ago
Which angle below is an obtuse angle? Vertical lines AC and BE are parallel to each other. Line CD, drawn from point C is perpen
VashaNatasha [74]
The answer is C. angel ADC
3 0
3 years ago
Which choice lists the Linnaean taxons in the correct order from least specific to most specific?
Lorico [155]

Answer:

a) Kingdom, phylum, class, order, family, genus, species.

Explanation:

Kingdom is the broadest taxonomic category after domain as proposed by Linnaeus. The Linnaean hierarchy of taxon identifies species as the most specific taxon that include only those organisms that can interbreed to produce the fertile progeny.

Several species with some common features are placed in same genus while related genera are placed in same family. Likewise, related families are placed in same order and the related orders are placed in same phylum.

Hence, kingdom is the least specific or broadest taxon that includes all the related phyla while species is the most specific taxon that include only the organisms that can interbreed.

7 0
3 years ago
Read 2 more answers
Under what conditions will light bend? A:Never B:While going through space C:When it stays in the same medium D:When it passes f
Veseljchak [2.6K]
The answer is D. Light bends as it passes from one medium to another
6 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following statements regarding erythrocytes is true
    7·1 answer
  • DNA copying can be done by bacteria or by using
    10·2 answers
  • How do the light and dark reactions work together?
    12·1 answer
  • An amino acid molecule includes a central carbon atom bonded to _____, a carboxyl group, and a hydrogen atom.
    6·1 answer
  • Explain the presence of starch in the parts of a plant that do NOT contain chlorophyll.
    10·1 answer
  • Why does the cells have to divide
    7·2 answers
  • For the trait of color in these beetles, where brown (B) is dominant to green (g), what is the genotype ratio of the possible of
    8·1 answer
  • THIS AQUATICS SCIENCE<br><br> Someone help it’s a quiz
    14·1 answer
  • knockout of the circadian clock protein per1 exacerbates hypertension and increases kidney injury in dahl salt-sensitive rats
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!