1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga_2 [115]
2 years ago
9

Were the gases used to create Earth's primitive Oceans and what were the contents of the liquid pool after the experiment ran fo

r a week?
Gases used to create Earth's primitive Oceans were nitrogen (N2), Oxygen (O2). Hydrogen peroxide (H2O2), and maybe some carbon monoxide (CO) and contents of the liquid pool after
experimentation were nitrides
Gases used to create Earth's primitive Oceans were, Oxygen, Hydrogen, Cesium, and Phosphorus and contents of the liquid pool after experimentation were nucleic acids.
Gases used to create Earth's primitive Oceans were, Oxygen, Hydrogen, Cesium, and Phosphorus and contents of the liquid pool after experimentation were Lipids.
Gases used to create Earth's primitive Oceans were nitrogen (N2), Carbon dioxide (CO 2), water vapor (H 20), and maybe some carbon monoxide (CO) and contents of the liquid pool after
experimentation were amino acids.
VOUS
Car Makan
Biology
1 answer:
Oksana_A [137]2 years ago
5 0

The gases present at the origin of the earth were believed to be nitrogen (N2), Carbon dioxide (CO2), water vapor (H20), and maybe some carbon monoxide (CO).

<h3>Origin of the earth</h3>

The earth is believed to have originated in what scientists have referred to as the big bang in which several gases were formed.

The gases present at the origin of the earth were believed to be nitrogen (N2), Carbon dioxide (CO2), water vapor (H20), and maybe some carbon monoxide (CO). The gases aggregated to form amino acids hence the origin of the initial life forms.

Learn more about gases: brainly.com/question/1369730

You might be interested in
What happens to a species when it becomes extinct? A. A few members adapt to a new environment. B. Most members move to a new en
blagie [28]

Answer:

D. is your answer

3 0
3 years ago
Read 2 more answers
What's the most common rock on earth?<br><br>Plz help, thx
nlexa [21]
Calcite is the most common rock

8 0
2 years ago
Read 2 more answers
Amino acids come from which type of organic molecule?
ivanzaharov [21]

Answer:

QUESTION:

amino acids come from which type of organic molecule?

ANSWER:

<em><u>Proteins</u></em>

Proteins are polymers made up of nitrogen-containing monomers called amino acids. An amino acid is a molecule composed of an amino group and a carboxyl group, together with a variable side chain.

Explanation:

Hope that this helps you out! :)        

If you have any questions please put them in the comment section below this answer.        

Have a great rest of your day/night!        

Please thank me on my profile if this answer has helped you.

5 0
2 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
What are some random changes in mutation
Anni [7]

Answer:

the most random changes of mutation is mainly an organisms physical appearance

5 0
3 years ago
Other questions:
  • This layer is the largest layer:
    15·1 answer
  • Why would it be hard to find the ideal CO2 level if the light intensity were very low?
    5·1 answer
  • What are two main components of a virus
    13·1 answer
  • Which nitrogenous bases are always paired with each other in the dna double helix?
    11·1 answer
  • What is a possible benefit of studying plants in the rain forest?
    5·1 answer
  • Paramecium are classified into which of the following categories
    13·2 answers
  • Which statement best describes the role of DNA
    8·1 answer
  • . A good friend of yours has informed you of his desire to purchase a plot of land for sugarcane and rice farming. When you deci
    10·1 answer
  • 3. What is the difference between individual characteristics and class characteristics?
    5·1 answer
  • Classification of mycelium​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!