1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AURORKA [14]
2 years ago
15

According to the video, Municipal Clerks issue permits and licenses for what things? Check all that apply.

Law
2 answers:
Klio2033 [76]2 years ago
8 0

Answer:

where is video you are making fool to us

Vaselesa [24]2 years ago
4 0

Answer:

a

Explanation:

You might be interested in
1. What are some of the things the team at the Forensic Anthropology Lab is able to determine by
raketka [301]

Answer:

1. What are some of the things the team at the Forensic Anthropology Lab is able to determine by studying bones?

Some of the things they are able to determine are what kind of prenatal environment they may have had, what kind of childhood they may have had, if it affected their stature, if it affected their dentition, their diet, and even their climate sometimes

2. Based on the individual’s remains discussed in the video, explain how Dr. Ann Ross and her team were able to determine the person died violently?

Due to the damage done to the skull—they found bullet holes. They then passed this information on to the authorities

3. Explain how researchers obtained information about the individual’s race, sex, height and connection with the local area?

They analyzed what they found. They measured, and compared the bones to find the individual’s race, sex, height, and location .

Explanation:

6 0
3 years ago
It is usually most slippery
Marysya12 [62]
I think is A but am not sure
8 0
3 years ago
Read 2 more answers
Today, every State’s constitution?
andrew11 [14]

B. follows the national pattern of provide only a broad outlined of governmental structure

3 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Prior to IDEA '97, the discipline of students with disabilities was governed by rulings in numerous lower court cases concerned
DiKsa [7]
I believed the answer is true
6 0
3 years ago
Other questions:
  • What is the correct hand signal to indicate a right turn?
    8·1 answer
  • According to the narrator,what kind of person is Antonia
    13·1 answer
  • What can the president be impeached for
    10·2 answers
  • Increased visibility can be achieved by allowing cyclists to merge with regular traffic...
    10·1 answer
  • why do guy keep telling us to smile. plz stop we will smile when we wanna not when we are told to. unless pics of course
    6·2 answers
  • What is it known as when both the federal government and state government share a particular power?
    7·1 answer
  • PLEASE NOOO LINKS!!!! Help!
    12·1 answer
  • Use this circular flow diagram illustrating the roles of businesses and individuals in both the Product and Resource (factor) ma
    11·1 answer
  • Why should people not vote?
    8·2 answers
  • Define Depreciation.​
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!