1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ziro4ka [17]
2 years ago
7

A type of cell that has a nucleus which is surrounded by a membrane.

Biology
1 answer:
Pani-rosa [81]2 years ago
6 0
It’s Eukaryotic cells
You might be interested in
A news report shows a city right after
nydimaria [60]

Answer:

yes

Explanation:

because earthquakes can start fires when gas lines are dislodged due to the earth's shaking.

7 0
3 years ago
Scientists use tools to
marissa [1.9K]

Answer:find basic information and to make of for. Hypothesis or production

Explanation:

6 0
3 years ago
A large hole that opens in the ground as a result of overpumping groundwater is a _____.
kondaur [170]
It is b. A sinkhole. Cause the hole will open and everything fall in it
8 0
3 years ago
Read 2 more answers
Bile salts break up the fat globule into smaller fat droplets. This role of bile salts is best described as ________.
Gemiola [76]

Answer:

Lipid emulsification.

Explanation:

Lipid emulsification generally defined as the spread of one form of liquid into second immiscible form of liquid with hydrophobic, or electrostatic, or hydrogen bonding interaction.

The above scenario is about lipid emulsification in which bile salts travels through bile duct along with chyme where these bind with their hydrophobic region to the big fat globules and then break up them into smaller fat droplets and then enter into the duodenum.

8 0
3 years ago
Read 2 more answers
The cell has a cell wall and many organelles including mitochondria and nucleus a vacuole and several chloroplast
umka2103 [35]
This would be a plant cell which is a eukaryote
7 0
4 years ago
Other questions:
  • Which characteristic can be inherited
    9·2 answers
  • Which process do heterotrophic organisms use to release energy?
    9·2 answers
  • What needs to be added to soil to create topsoil?
    13·1 answer
  • Sequence describe the steps involved in the synthesis, packaging, and export of a protein from a cell.
    9·1 answer
  • What is the difference between a nucleoside tetraphosphate and a tetranucleotide? What is the difference between a nucleoside te
    10·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which of the following statements best describes the structure of a carbohydrate?
    5·1 answer
  • This pyramid of numbers is modeling organisms within an ecosystem.
    10·1 answer
  • Whoever answers I will mark brainlest
    11·1 answer
  • Which best illustrates how comparative anatomy supports the modern theory of evolution
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!