1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalija [7]
2 years ago
9

Pick the statement that is correct regarding fermentation. (1 point)

Biology
1 answer:
kirza4 [7]2 years ago
6 0

Lactic acid fermentation is performed by animals and bacteria, and produces lactic acid and NAD+. It is an anaerobic process.

<h3>What is fermentation?</h3>

Fermentation is an anaerobic process by which animals and bacteria can produce energy in the form of ATP in absence of oxygen.

Fermentation is less efficient in terms of the generation of ATP when compared to cellular respiration.

Alcoholic fermentation is well known to generate ethanol, carbon dioxide (CO2), and NAD+, whereas lactic acid fermentation generates lactic acid and NAD+.

Learn more in:

brainly.com/question/12073833

You might be interested in
Bath salts bath salts are powders that release an intoxicating fragrance when poured into hot water. can produce anxiety, agitat
Mnenie [13.5K]
The rest are incorrect:Bath salts can produce anxiety, agitation, hallucinations, and paranoia even in low doses, not just when used at high doses.Bath salts cannot cause a rapid drop in blood pressure and heart rate, instead it causes rapid increase when ingested, snorted, or injected.Bath salts are not synthetic drugs like mdma (methylenedioxy-methamphetamine).
7 0
2 years ago
The thee parts of the Cell Theory are
Molodets [167]

Answer:

Cells come from other living cells

All living things are composed of one or more cells

The cell is the basic unit of life.

4 0
3 years ago
Read 2 more answers
A gene is a section of DNA within a chromosome that codes for a(n)
insens350 [35]

Answer:

B. specific protein.

Explanation:

8 0
2 years ago
Read 2 more answers
In the citric acid cycle, the enzyme succinate dehydrogenase catalyzes a reversible reaction using FAD/FADH2 as an oxidizing/red
Aliun [14]

The statement which best explains how the redox component of this reaction contributes to the reaction's ability to be reversible under cellular conditions is; <em>Choice D: The change in the biochemical standard reduction potential is small.</em>

Discussion:

A reversible process is one in which the system and environment can be restored to exactly the same initial states that they were in prior to when the process occurred, if we go backward along the path of the process.

  • However, the necessary condition for a reversible process is therefore the quasi-static requirement.

  • The quasi-static requirement in this case is that the change in the biochemical standard reduction potential is small.

Read more:

brainly.com/question/13195211

5 0
2 years ago
Which situation would an epidemiologist most likely study? a serious disease outbreak that infects hundreds of people a genetic
Zigmanuir [339]

The correct answer is A. A serious disease outbreak that infects hundreds of people

Explanation:

In science, the epidemiology is a fill that studies diseases especially in terms of the way diseases emerge and then spread in populations or the way diseases become epidemics. This implies, epidemiologists focus on diseases outbreaks rather than on inherited diseases. Moreover, epidemiology plays an important role in preventive health as well as actions to control epidemics. Considering this, it can be concluded an epidemiologist is likely to study " A serious disease outbreak that infects hundreds of people" because epidemiologists focus on the causes, transmission, and outbreaks of epidemics which are diseases that spread in a population.

3 0
3 years ago
Other questions:
  • What must every good hypothesis have
    10·2 answers
  • Using the graphs below , which group of moths is better adapted to survive the hunting cycle
    11·2 answers
  • The point where the muscle attaches to the more movable bone in a joint is referred to as the , and the point where the muscle a
    5·1 answer
  • Why is cellular respiration important for plants and other photosynthesizing organisms
    15·2 answers
  • Darwin’s observations of finches indicated descent with
    12·1 answer
  • The rate at which molecules water and oxygen can enter a cell is determined by the-
    7·1 answer
  • Which phrase describes how vestigial structures provide evidence to support that life changes over time?
    6·2 answers
  • If a promoter is found within a nucleosome, how would it be possible to express that gene if needed?
    14·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Help me pls! In your own words, explain how the information carried by mRNA is used in the ribosome to form proteins. Be sure to
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!