The main goals of the Human Genome Project were to provide a complete and accurate sequence of the 3 billion DNA base pairs that make up the human genome and to find all of the estimated 20,000 to 25,000 human genes.
Hope I Helped!
Mark Brainliest!
The answer to this question is:
true
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The type of direct that increases glycogen stored in muscle and endurance time at marathon speed most is high carbohydrate. Option C.
<h3>What is glycogen?</h3>
The term glycogen refers to the form in which carbohydrate is stored in the body. The energy that is stored as glycogen in the body can be slowly released when required by hydrolysis of the glycogen molecule.
The type of direct that increases glycogen stored in muscle and endurance time at marathon speed most is high carbohydrate. Option C.
Learn more about glycogen:brainly.com/question/14466525
#SPJ4
Missing parts;
Which type of direct increases glycogen stored in muscle and endurance time at marathon speed most? A. high fat B. mixed C. high carbohydrate D. fasting
In low light no plants grow. With no plants no animals can eat so less animals remain or stay there. With less animals less animals respire and breathe out CO2.
