1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SOVA2 [1]
2 years ago
5

PLEASE HELP!!! Solve the quadratic equation by completing the square.

Mathematics
1 answer:
kow [346]2 years ago
5 0

The values of x in the quadratic equation using completing the square method are x=-4 \pm \sqrt{5}.

Given information:

The quadratic equation is x^2+8x+11=0.

It is required to factorize the given quadratic equation using completing the square method.

<h3>How to factorize a quadratic equation?</h3>

Use completing the square method to solve the equation as,

x^2+8x+11=0\\(x)^2+2(x)(4)+4^2-4^2+11=0\\( (x)^2+2(x)(4)+4^2)-4^2+11=0\\(x+4)^2-16+11=0\\(x+4)^2=5\\(x+4)=\pm \sqrt{5} \\x=-4 \pm \sqrt{5}

Therefore, the values of x in the quadratic equation using completing the square method are x=-4 \pm \sqrt{5}.

For more details about quadratic equation, refer to the link:

brainly.com/question/2263981

You might be interested in
What are the zeros of Ax) = x(x-9)?
Nataliya [291]

Answer:

x = 0, 9

Step-by-step explanation:

To find our roots, set the binomial factors equal to zero:

x = 0

x - 9 = 0

x = 9

3 0
4 years ago
Read 2 more answers
The volume of a cube is 620?m3.<br> Work out the length of its side rounded to 1 DP.
butalik [34]

Answer:

8.5 m

Step-by-step explanation:

the volume of a cube is calculated via

length of side ³

620 = side length³

side length = 8.5 m

6 0
3 years ago
What does pie equal
Zigmanuir [339]
It equals 3.14 (: Hope this helps
6 0
3 years ago
Read 2 more answers
there are 7 teams in the soccer tournament.there are two coaches on each team and 10 kids play on each team.which sentence below
Mademuasel [1]

Answer:

I think it's letter B, sorry I'm not sure

4 0
3 years ago
Harper wants to exchange £350 for dollars, how many more dollars would she get in the bank than in the post office
musickatia [10]

Answer: $24.50

Post office:£1 = $1.27

£350 = $1.27 × 350 = $444.50

Bank:£1 = $1.34

£350 = $1.34 × 350 = $469

Therefore, the difference will be:

= $469 - $444.50

= $24.50

8 0
3 years ago
Other questions:
  • A ____________________number can be expresses as a/b where a and b are integers and b does not equal 0.
    7·2 answers
  • There are 13 dancers in the front row.7dancers are in the back row. How many fewer dancers are in the back row than are in the f
    11·2 answers
  • Is 0.790 greater than or equal to 0.79?
    8·1 answer
  • How to do a simulation
    10·1 answer
  • Which expression has a value of 40?
    14·2 answers
  • Help please..? its an important grade
    15·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Between what two consecutive integers where does the Square Root of 115 lie?
    7·1 answer
  • HELPPPPPP SOLVE FOR Y
    5·1 answer
  • BRAINLIEST! URGENT! If you answer both and leave an explanation, I will mark you brainliest!​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!