1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Virty [35]
3 years ago
15

Difference between bacteria and virus ​

Biology
2 answers:
Vitek1552 [10]3 years ago
8 0
The difference is that bacteria is germs that most likely make u sick and virus means that can make u sick
dusya [7]3 years ago
4 0

                        differences between bacteria and virus ​

  • bacteria has cell wall whereas virus does not has a proper cell wall.
  • bacteria are living cells which can live inside or outside of the body whereas virus needs a host to survive.
  • Bacteria contains ribosomes whereas there is no ribosomes in virus.
  • Virus is more dangerous than Bacteria
You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
4 years ago
In photosynthetic cells as green algae and plant cells, , synthesis of ATP by the chemiosmotic mechanism occurs during ________.
ddd [48]
Answer: A- Photosynthesis and respiration.
7 0
3 years ago
The greenhouse effect _____________. select one:
iren [92.7K]
D. is a recent development resulting from the burning fossil fuels
3 0
3 years ago
Lysosomrs can be compared to the recycling and garbage centers of a city. How can this comparison be justified
IgorLugansk [536]
Lysosomes use a degenerative enzyme to eliminate un necessary materials from the cell and recycle parts that can be re used, much like a recycling centers eliminate waste from cities and find ways to reuse it.
4 0
3 years ago
During.the process.of.cellular.respiration glucose.is.converted.into.what
AveGali [126]
It is converted into Carbon dioxide which is given off as a waste product
5 0
4 years ago
Other questions:
  • Which is a part of the cell theory?
    9·1 answer
  • Where on earth is the greatest amount of oxygen stored?
    11·1 answer
  • Members of phylum cnidaria are more closely related to members of phylum porifera than to bilateral animals. True or False
    5·1 answer
  • You have been assigned a DNA stretch. What is the complementary strand when you replicate the template
    12·1 answer
  • Most mammal cells divide at a rate of
    12·1 answer
  • Which of the following is an abiotic factor you might find in a desert
    10·2 answers
  • What is the purpose of genetically modified crops?
    13·1 answer
  • Cuales otras situaciones mas visto con el uso del celular que demuestre que no lo usan de forma racional. Enumera e ilustra 3 de
    11·1 answer
  • A deletion or insertion of one or more nucleotides may result in a frameshift mutation true or false
    14·1 answer
  • In one to two sentences, explain why there is more concern for severe storms in low-pressure systems.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!