Answer:
1.31 cM
Explanation:
Total offspring = 2205
Since two genes are involved, F1 progeny should have four types of combination. Out of them two are 17 and 12 which definitely means they are in lesser number. Since recombinants are always less than parental progeny in linkage, the given two types are recombinants.
Recombination frequency = (Number of recombinants / Total progeny) * 100
= [ ( 17 + 12 ) / 2205 ] * 100
= ( 29 / 2205 ) * 100
= 1.31 %
Map distance = Recombination frequency
Hence, distance between two genes = 1.31 cM
Answer:
A. Increasing surface area to improve nutrient absorption between the digestive and the circulatory systems.
Explanation:
Our intestines, on the inside, are lined with the intestinal mucosa. This mucosa is not straightened, as it might seem macroscopically; it rather has this wavy appearance forming folds. Also, epithelial cells in this mucosal layer have lots of small finger-like extensions called the villi.
Folds and villi increase the contact surface between the nutrients in the lumen and mucosa, thus increasing the rate of absorption of these nutrients between the intestines and the blood vessels below the epithelium.
'E' letter for Trachea indicates a flexible tube that has c-shaped cartilaginous rings that keep it from collapsing.
- There are many cartilage rings in a typical trachea (windpipe) (a strong and flexible tissue). These C-shaped rings give your child's trachea support while enabling it to bend and move naturally during breathing.
- These rings are O-shaped rather than C-shaped due to a congenital anomaly known as full tracheal rings. Your youngster may get aberrant windpipe thinning and airway stenosis as a result. The trachea has between 16 and 20 rings.
- This cartilage defect may have an influence on any number of those rings. While some kids with full tracheal rings may at first only show minor breathing issues, other kids might be in serious respiratory distress.
Learn more about the Trachea with the help of the given link:
brainly.com/question/2560510
#SPJ4
Explanation:
Genetic variation is increased by meiosis
Because of recombination and independent assortment in meiosis, each gamete contains a different set of DNA. This produces a unique combination of genes in the resulting zygote. Recombination or crossing over occurs during prophase I
Answer:
If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT
If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU
Explanation:
