1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BARSIC [14]
2 years ago
8

“how many eggs form in meiosis? what else forms and why “

Biology
2 answers:
kakasveta [241]2 years ago
8 0

Answer:Meiosis contains two separate cell divisions, meaning that one parent cell can produce four gametes

Explanation:

because I am smart

Ber [7]2 years ago
3 0

Answer:

One egg forms in Meiosis.

as well as Four Gametes

Explanation:

You might be interested in
Que tipo de celula es un virus
Feliz [49]

Answer:

Un virus no es una célula sino un organismo microscópico que invade las células de sus huéspedes.

Explanation:

5 0
3 years ago
How can i use point mutation in a sentence
Flura [38]
It was at that POINT MUTATION began
6 0
3 years ago
Which of the following statements is true concerning biodiversity?
Mamont248 [21]

Last one - Biodiversity is the diversity of species in an area, which makes an ecosystem better prepared for major changes

Explanation:

If one crop struggles to grow then there will be plenty of others to substitute it. If a prey animal is dying at a faster rate and harder to find, predators can have other prey options and so forth. Biodiversity makes it so ecosystems can get past change.

3 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
What is a thin piece of glass that is placed over the specimen on the microscope called?​
Rudik [331]

the specimen ... is what’s it’s called

8 0
3 years ago
Read 2 more answers
Other questions:
  • Will there be the second coming of alha.
    14·2 answers
  • "after 12 hours without eating, seth is very hungry. it is likely that seth's blood glucose level is _______________ and his blo
    5·1 answer
  • Which atom(s) in the molecule of water are slightly positive _____________________?
    14·1 answer
  • What would happen if decomposition did not occur?
    5·1 answer
  • What are three examples of imprinting?
    7·1 answer
  • Which describes a Mendelian trait?
    14·2 answers
  • Lactic acid fermentation is an anaerobic process. *<br><br> True<br> False
    14·1 answer
  • Which statement best describes the meaning of the term fossil
    10·1 answer
  • When is the kinetic energy of a pendulum the least?
    10·2 answers
  • Helpppppppppppppppppppp
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!