The young regions of the Arabian peninsula have acquired protection from outsiders like the Ottoman Empire to defend the British rulers. Soon after the development of Islam took place in such regions generated culture of peninsula. Below number of aspects are given which discuss about the affect on population pattern on Arabian peninsula:
<u>Independence: </u>
Kuwait earned independence during mid 1900s while UAE signed treaty with Britain in 1971 and acquired freedom. The UAE was comprised of tribal population "sheikhdoms" and ruled by Islamic religious leaders, while Kuwait and Oman are constitutional emirates headed by emirs or prince.
<u>Living Standard and Culture:</u>
The living standard for urbanized nation in peninsula is based on oil production, manufacturing and trade. The Arab culture initiated to have foreign workers to cater need of growing industries. Number of people follow monarchial life style and simple too.
<u>Religion and Language:</u>
Most states have "Sunni & Shia Muslims" which are dominant sects of Islam and follow to visit hajj or pilgrimage i.e Makkah, atleast once by an individual in his or her lifetime. Some other categorization also seen in the form of Islam like Oman practice "Ibadhism" as considered to practice moderate conservatism. The language is basically Arabic only, but some other seen are English, South-Asian and Afro-Asian languages.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
D. Haiti
Explanation:
Voodoo was originally from Haiti.
The best answer would be A. C<span>lear, distinct horizons with organic matter and mineral nutrients is a characteristic in a land that is to be used for farming. A healthy soil is an essential when planting crops thus it should have ample amount of organic matter and nutrients.</span>
