1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhenek [66]
1 year ago
8

Explain why it would not be possible to accurately measure hemoglobin concentration if the RBCs were not first lysed

Biology
1 answer:
ss7ja [257]1 year ago
8 0

We have that the structure of Red blood cells, causes the membranous shade to be  lysed to get precise hemoglobin level.

<h3>Red blood Cell</h3>

Generally, the Red blood cell  is blanketed with the help of proteins and lipids, the purple shade of Red blood cells or blood is due to the presence of hemoglobin.

Hemoglobin is <em>considered </em>in the central phase of the pink blood cell. Red blood cells lacks nucleus.

The structure of Red blood cells, causes the membranous shade to be  lysed to get precise hemoglobin level.

For more information on blood visit

brainly.com/question/14415488

You might be interested in
Landfills emit_______gas<br> petroleum<br> methane<br> oxygen<br> butane
yuradex [85]

Methane the most, small amount of oxygen and other gases

8 0
3 years ago
When a nutrient moves freely across the cell membrane from an area of higher nutrient concentration into an absorptive cell wher
kipiarov [429]

Answer: diffusion

Explanation:

Diffusion is the over all movement of molecules from one region where it is in high concentration to another another region where it is in lower concentration.

This movement continues until the concentration of both regions are equal. Smaller non polar molecules are able to diffuse through the lipid bilayer of the membrane .

Movement through the membrane is dependent on the concentration gradient, that is the difference in concentration between the two areas.

It is also dependent on the size of the molecule

5 0
3 years ago
Chemically speaking, enzymes are composed of chains of _________________, and they are considered to be a type of ______________
Zarrin [17]
Chemically speaking, enzymes are composed of chains of amino acids, and they are considered to be a type of protein.
6 0
3 years ago
Abby is walking to school with her best friend Jaylyn. They begin talking about everything they see including the ash trees, gra
mart [117]

Answer: Ecosystem

Explanation:the ecosystem is a network of organisms,their environment and their interaction in a particular place.it involves the interaction between the different organisms that make up a community and it's non-living environment.

The living organisms share resources with each other and include autotrophs, heterotrophs,decomposers; trees,grasses,insects, animals etc.

The non living components include rainfall,air water etc

4 0
3 years ago
Read 2 more answers
A complex multicellular organism has different levels of organization. What is the order of these
musickatia [10]

Answer:

A complex multicellular organism has different levels of organization. What is the order of these levels?

OC cells, tissues, organs, organ systems

~batmans wife dun dun dun...

5 0
3 years ago
Other questions:
  • The most common cause of chronic pelvic pain for women in the prime of their reproductive years is:
    7·1 answer
  • What are the chances of the offspring for having a round shape?
    12·1 answer
  • What is caused by stress and is the bending, tilting, and breaking of rock?
    14·1 answer
  • Explain how increased CO2 in the atmosphere results in greater acidification of oceans and describe the effect on marine organis
    11·1 answer
  • What is the part of the cell cycle process by which chromosomes in a cell nucleus are separated into two identical sets of chrom
    14·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • 1. ¿De cuantas personas estuvo conformada esta familia y en que tipología se encuentran? En -(Lucas 2:1-40)
    5·1 answer
  • Which of the following most directly affects the direction of the Gulf Stream?
    6·1 answer
  • Many birds migrate to warmer climates in the spring. Find two reasons why. Group of answer choices To get away from seasonal pre
    10·1 answer
  • The Calvin cycle requires the energy from ______ and ______ which are produced in the light reactions.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!