1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashutka [201]
2 years ago
5

Which organisms, out of fish, chicks, mouse, and human embryos, would be more closely related and which would be less closely re

lated?
Biology
1 answer:
Rainbow [258]2 years ago
4 0

Answer:

the chicks and mouse would be losely conected because they have more of the same gentic material and fish and humans would havwe the same since they kind act like the same because The recent advances in developmental biology described  have established the central importance of a small number of highly conserved signal transduction pathways that mediate cell interactions crucial for animal physiology, reproduction, and development. It seems likely that many developmental toxicants might affect development by acting on those pathways. Application of the methods that have been so successful in elucidating them should now allow scientists to investigate that possibility and to determine the mechanisms by which developmental toxicants act. This chapter reviews the experimental approaches primarily responsible for the recent advances in knowledge about animal development and discusses how those approaches might be applied to developmental toxicology. Chapter 8 discusses how those approaches might lead to improved qualitative and quantitative risk assessment.

You might be interested in
Ethyl alcohol is a byproduct of both Lactic Acid and Alcoholic Fermentation.
jasenka [17]

Answer:

False

Explanation:

Ethyl alcohol is formed only during alcoholic fermentation and in lactic acid fermentation lactic acid is formed

3 0
2 years ago
Read 2 more answers
Brain energy requirement, metabolism and neurotransmitter turnover consume ____ % of the available oxygen and glucose in the bod
klemol [59]
Brain energy requirement, metabolism and neurotransmitter turnover consume 20 % of the available oxygen and glucose in the body.

  <span>Even though, the brain is only about 2% of the body weight, it consumes about 20% of the body's energy. It is the main consumer of glucose-derived energy. When the mental strain increases, the brain's demand for energy in the form of oxygen and glucose is higher.</span>
8 0
3 years ago
Read 2 more answers
Where do bile and pancreatic enzymes enter the small intestine?
BartSMP [9]

Answer:

The correct answer is duodenum

Explanation:

Bile is a digestive enzyme that is secreted by the liver which is temporarily stored in the gall bladder and pancreatic enzyme is released by the pancreas. The bile is secreted to the small intestine through the common bile duct and the pancreatic duct joins the common bile duct just before ampulla of Vater which opens in the first intestinal portion which is duodenum.

So bile and pancreatic enzymes enters the duodenum region of the small intestine and after getting in the small intestine it digests the complex macromolecules into simpler and smaller form which can be absorbed through the intestinal epithelium.  

7 0
3 years ago
How does carbon enter the soil
Eva8 [605]
It's fused into natural mixes by autotrophs and enters the dirt when living beings die.
7 0
3 years ago
Illustrate how body cavities distinguish branches of development of animals with bilateral symmetry.​
Katarina [22]

Answer: no body cavity—acoelomates; body cavity not completely lined with mesoderm—pseudocoelomates; body cavity completely lined with mesoderm—coelomates

7 0
3 years ago
Other questions:
  • The p wave of a normal electrocardiogram indicates ________.
    7·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Ribosomes
    13·1 answer
  • Where is the mantel located in the clam
    15·1 answer
  • At the end of meiosis are the daughter cells haploid or diploid
    14·1 answer
  • How do scientific models provide a practical solution for some types of research? Check all that apply.
    11·1 answer
  • Wat is the primary evidence that dinosaurs existed in the past
    8·1 answer
  • What is carbon fixation?
    11·1 answer
  • 3. Your body needs protein. Protein is broken down into amino acids that are then used to build the
    10·1 answer
  • Which is true about a valid scientific hypothesis
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!