B! we had to alter them to our preferred taste and nutrients
the mitochondrion is where it takes place
1. Drugs
-it’s important that teens know what’s out there and what some of these drugs can do to people.
2. Sex
-adults/parents need to stop acting like this is something bad, it’s normal and they need to teach us how to protect our selves and same gender sex as well bc high school and probably middle school students are confused and need help but they can’t ask their parents bc they are too afraid.
3. Buying a house, car, investment
- it might be early but students need to know these stuff about life
4.Money management
- students go into a deep debt and can’t get out bc they didn’t know how to manage their money and go crazy with loans
Answer:
Cell Bacteria Virus
Explanation:
Assuming it means Eukaryotic cells, they are larger than bacteria. Viruses are smaller than bacteria.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
