Answer:
GAAUUGUGGGGACUGAAGCGCGGCAGC
Explanation:
The process whereby a mRNA molecule is formed from a DNA template is called TRANSCRIPTION. The mRNA formation follows the complementary base pairing rule which says that Adenine is bonded to Thymine (Uracil in RNA) i.e A-T(U) while Guanine is bonded to Cytosine i.e. G-C.
Based on this, a DNA molecule with base sequence: CTTAACACCCCTGACTTCGCGCCGTCG will be transcribed into a mRNA strand with base sequence: GAAUUGUGGGGACUGAAGCGCGGCAGC
Answer: I believe the answer is C. Contractions are informal
Explanation:
The electrochemical impulse is composed of an action potential travelling from the dendrite to the cell body to the axon of the neuron. The main neurotransmitter is acetylcholine which is released at either the synapse or the neuromuscular junction.
Answer: A, excessive pollution decreases a communities access to affordable clean water.
Explanation: ap3x