1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
3 years ago
9

A change in the number of neutrons in an atom will change the isotope. What will happen when the

Biology
2 answers:
Zina [86]3 years ago
6 0

Answer:

increasing the number of protons would increase the positive charge of the atom and that makes it an ion

Explanation:

garri49 [273]3 years ago
5 0

Answer:

A couple of things that will happen if you change the number of protons, electrons, and neutrons in an atom. If you change the number of protons in an atom somehow, then there will be less positive charge. If you change the number of neutrons somehow, nothing will happen because it carry's no charge at all.

Explanation:

You might be interested in
35. The activities of life, including chemical reactions, require __________.
Svetllana [295]

Answer:energy

Explanation:all activities of life including physical and chemical require energy to proceed

8 0
4 years ago
Read 2 more answers
Review Test Questions
Allushta [10]

Answer:

• O A. ACUUGGCGACGU

Explanation:

Anticodons of tRNA have same sequence as of any DNA code they are for. Why? <em>This is because original DNA is transcripted into a mRNA sequence which is complementary to the original DNA sequence. This mRNA is complementary to the original sequence while the anticodons on tRNA are again complementary to the mRNA sequence,</em> which in-turn means that they have exactly same sequence as of original DNA. This is how they interpret the original cod and manifest the expression of correct amino acids as they are present in parents.

Hope that helps!

7 0
3 years ago
Which organs are responsible for destroying old red blood cells?
Elan Coil [88]
<span>Spleen is also known as the graveyard of RBC, if it helps u 

1.Stem cells in bone marrow make all blood cells. RBC lives about 120 days. 
RBC are destroyed in Spleen. This process takes place as: 
- RBCs are ruptured. 
- Heme and globin portions separated. 
- Globin > amino acids. 
- Iron transferred in transferrin into the blood > into bone marrow for reuse. 
- Heme > Biliverdin > Bilirubin > liver >small intestine. 



2.Reticuloendothelial cells participate in the destruction of senescent RBC's. The spleen is a well suited site of RBC destruction given that cells must course through 2-3 micron apertures in the walls of splenic sinusoids, which is an ultimate test of cell pliability. Rigid cells are entrapped and phagocytosed. Intra-erythrocyte inclusions are removed during splenic circulation. 
Destruction of RBCs happens within reticuloendothelial cells – NOT in the circulation. Globin and heme get recycled, porphyrin is degraded to bilirubin which is conjugated by the liver and excreted in the gut. Rate limiting step is conjugation. Indirect (unconjugated) bilirubin is result if this doesn’t happen. 
Normally ~10% RBCs lyse while in circulation Þ Hgb gets released into circulation and rapidly disassociates into alpha and beta dimers which are bound by haptoglobin. The Hgb/haptoglobin complex is transported to the liver. If haptoglobin is depleted, free Hgb circulates and is filtered by the kidney. Free Hgb is either reabsorbed by renal tubular cells or excreted as free Hgb in the urine. 


3. Another site reported that 
RBC destroyed in liver and spleen, by macrophages. 2 million destroyed per second. 
Hb is released and iron is recovered and returned to bone marrow.</span>
3 0
3 years ago
Genetic variation occurs in what type of reproduction?​
Gekata [30.6K]

Answer: Sexual reproduction

Explanation: Sexual reproduction, also known as meiosis, involves two organisms. Meiosis results in four haploid cells that are genetically different due to crossing over in prophase l, random fertilization, and the arrangements of chromosomes in metaphase l.

3 0
3 years ago
The boxes show parts of the body at different levels of organization. What statement about the chart is true?
____ [38]

Hey ur answer should be D

I hope this helps besides I waas really good at Biology

7 0
3 years ago
Read 2 more answers
Other questions:
  • If cells were placed in a solution, and you observed them shrinking, the solution is probably _____.
    13·2 answers
  • While containing small amounts of lime, soda ash and silica, glass is primarily made of what substance?
    14·1 answer
  • Which statement described a difference between the nitrogen and carbon cycles?
    8·1 answer
  • Describe the effects of the increase in temperature over the past 100 years.
    7·1 answer
  • The concentration of a sugar is high inside a cell and slightly lower outside the cell. What is most likely to occur if the suga
    10·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Which of these is included under land use? A. water B. rocks C. trees D. soil E. applying pesticides
    14·2 answers
  • Explain the complementary of the DNA molecule and how it is held together within the strand
    15·1 answer
  • Why are decomposers called nature s recycling trucks?
    15·1 answer
  • I WILL GIVE BRAINLIEST
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!