1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scorpion4ik [409]
2 years ago
9

How is self-pollination similar to cross-pollination? how is it different?.

Biology
1 answer:
lisov135 [29]2 years ago
8 0

Answer:

Self-pollination occurs when the pollen from the anther is deposited on the stigma of the same flower, or another flower on the same plant. Cross-pollination is the transfer of pollen from the anther of one flower to the stigma of another flower on a different individual of the same species.Explanation:

You might be interested in
19. How do ctenophores move?
Leona [35]

Answer:

Explanation: Ctenophores move in water, they have a flapping motion.

hope this helps :)

3 0
3 years ago
Read 2 more answers
The number of mosquitoes at the beginning of the summer was 4,000. There were 500 born and 550 died. What is the growth rate of
Studentka2010 [4]

Answer:

-50

Explanation:

500-550

6 0
2 years ago
in my investigation, i saw that it can cause the growth of algal blooms which can be toxic to wild life and humans. this could a
damaskus [11]

Answer:

hi I am new pls follow me

5 0
1 year ago
what loop prepares the body for change. This is in contrast to a feedback loop that a. brings a parameter back into the set rang
11Alexandr11 [23.1K]

Answer:

The correct answer is - negative feedback loop.

Explanation:

A negative feedback loop takes place in the biology when the end product of a particular reaction leads to decrease in the reaction. A negative feedback loop makes system to bring the homeostasis.

Negative feedback loops takes place inside the body of an individual to decrease the function of a particular reaction, it prepared the body for the change that occur in the atmosphere such as pH, temperature and other.

Thus, the correct answer is - negative feedback loop.

5 0
3 years ago
When one single allele/trait is being examined, it is called
Naddik [55]
Monohybrid cross
monohybrid cross
4 0
3 years ago
Read 2 more answers
Other questions:
  • Please help me.. ty if you do
    11·1 answer
  • What is the enlargement of an organ or tissue because of an abnormal increase in the number of cells?
    10·2 answers
  • Identify and describe the features found on the ocean basin floor
    8·1 answer
  • Which organisms are prokaryotes?
    10·2 answers
  • What happens at a transform fault?
    13·2 answers
  • Which part of an atom is
    5·1 answer
  • CAN YOU EXPLAIN?
    11·1 answer
  • Please help if you can thank you ^^
    6·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Why does this recent discovery about the galapagos finches prove that it’s often challenging for scientists to determine when tw
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!