1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ehidna [41]
3 years ago
10

10. What is the relationship between air temperature and precipitation? Why?

Biology
1 answer:
Agata [3.3K]3 years ago
4 0

Answer:

When the temperature increases there is more evaporation. When there is more evaporation the humidity increases due to more water molecules in the air. More humidity means more precipitation.

Explanation:

You might be interested in
1. If the DNA is carrying a silent mutation, what will be the impact it will have on the organism?
antiseptic1488 [7]
The DNA carrying a silent mutation will have no gene expression or result on the phenotype or physical appearance of the organism. Silent mutations code for the same amino acid resulting in more genetic diversity, having a genotypic advantage, but providing no noticeable differences.
3 0
3 years ago
The sternal is blank to the axillary
kiruha [24]
The sternal is blank to the axillary
6 0
4 years ago
Amed watched a video of someone using a jetpack rocket at a lake Water is pumped out of the lake into the jetpack, and then the
grin007 [14]

Answer:

there is no picture

Explanation:

6 0
3 years ago
HELP PLEASE
Sphinxa [80]

Boiga irregularis or brown snake is a slender, climbing snake with a vertical pupil and large eyes, providing it better nocturnal vision. The species has no natural predator. When the brown snake is accidentally released into the island, it will result in local extinction of the majority of the island's native lizard and bird species.

It will also result in cascading ecological influences by eradicating native pollinators, resulting in the corresponding reduction of the native plant species.

Hence, the correct answer will be fewer birds and more snakes.

4 0
3 years ago
Assign the various toppings you put on pizza to the appropriate domains and kingdoms. ...
Feliz [49]

Assigning the various toppings of pizza to their appropriate domains and kingdoms according to biology are:

  • Bacteria (Kingdom Bacteria),
  • Archaea (Kingdom Archaea),
  • Eukarya (Kingdoms Animalia, Plantae, Fungi).

What is a domain?

The most common pizza toppings belong to eukarya domain and three kingdoms which are animal vegetal, and fungi.

Eukarya is the domain that groups all organisms formed by cells with a defined nucleus.

Also, Eukarya groups together the kingdoms of protist, animal, vegetal and fungus. All of the most common toppings are within the Eukaryota domain.

Examples are:

  • Chicken (animal)
  • Meat (animal)
  • Cheese (animal)
  • Mushrooms (fungi)
  • Sausages (animal)
  • Onion (vegetable)
  • Tomato (vegetable)
  • Corn (vegetable)
  • Pineapple (vegetable)
  • Pepperoni (animal)

Hence, the most common pizza toppings belongs to the Eukarya (Kingdoms Animalia, Plantae, Fungi) domain.

Read more about <em>domains </em>here:

brainly.com/question/16003434

#SPJ1

6 0
2 years ago
Other questions:
  • 30 POINTS! PLEASE ANSWER ASAP!
    7·2 answers
  • Cities closer to water most likely will be<br> A. More dry<br> B. More humid<br> C. Hotter
    10·2 answers
  • Many fast- acting medications are sold as powders, sometimes inside soluble capsules. Why would these medications act faster tha
    12·2 answers
  • 4. There are other types of reagents used to determine what type of biomolecule a substance is. For example, copper ions present
    14·1 answer
  • It takes energy and resources for a stickleback to develop spines. Thus, over time pelvic spines would not be retained in stickl
    8·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • 15 pennies and 5 nickels<br> Yes or No<br> Explanation:<br> 16 nennies and 2 nickels
    6·1 answer
  • Which of the following statements is true?
    7·1 answer
  • A structure found on the femur is the ________. Group of answer choices anterior crest trochlea intercondylar fossa medial malle
    9·1 answer
  • What is the difference between aggression and courtship?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!