1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scrat [10]
2 years ago
14

What is the difference between an ocean and a sea?

Biology
1 answer:
Mnenie [13.5K]2 years ago
6 0
A seems most probable.

Oceans are also deeper and larger then Seas.
You might be interested in
Transcribe and translate the following sequence:
ira [324]

Answer:

TCA GCC GGA I think this is right

7 0
2 years ago
From approximately 240 to 66 million years ago, dinosaurs dominated most of the land habitats on Earth. Around 66 million years
Harlamova29_29 [7]

The correct answer is option C, that is, mammals were able to diversify to make use of the variety of habitats that were previously occupied by dinosaurs.

Adaptive radiation refers to the comparatively fast evolution of various species from a single common ancestor. Adaptive radiation usually takes place when a species enters a novel area and distinct traits influence its existence. An illustration of adaptive radiation is the progression of mammals after the annihilation of dinosaurs.  


3 0
3 years ago
In what way can open-mindedness interfere with scientific progress
umka2103 [35]
<span>Open-mindedness does interfere with scientific progress as it can lead to acceptance of untested ideas. Open-mindedness can lead to actually accepting results that are not true. This is not a great angle for people involved with scientific experiments. Open-mindedness should be limited to the fact that the results can lead to negative answers. People that can accept this theory will ultimately succeed in their strive for creating something new. There is nothing wrong in discarding the results that does not seem to fit the bill.
Hope I helped!:)</span>
8 0
3 years ago
Red coloration in wheat seeds is a complex trait influenced by three unlinked genes, each with two different alleles A and a; B
Sauron [17]

Answer:

Red coloration in wheat seeds is a complex trait influenced by three unlinked genes, each with two different alleles A and a; B and b; C and c. This Punnett square shows the results of a mating between two plants that are both heterozygous at all three loci. The intensity of the red color phenotype is influenced by only one of the gene products. true or false?

False

3 0
3 years ago
The table gives the average temperatures and elevations of the inner canyon and the north rim of the Grand Canyon. Inner Canyon
sergiy2304 [10]
The north rim is higher so it'll be cooler
4 0
3 years ago
Read 2 more answers
Other questions:
  • A neuron in the skin detects tissue damage in the skin during a burn and informs the brain and spinal cord. This neuron is part
    5·1 answer
  • Describe three examples of intracellular digestion by lysosomes
    14·1 answer
  • Using the Hardy-Weinberg Law of Equilibrium, evaluate whether the populations are in equilibrium or not.
    8·1 answer
  • Which individuals neither have the trait nor are carriers?
    8·1 answer
  • What are some common features in prokaryotic and eukaryotic
    13·1 answer
  • What happens to most of the sunlight<br> energy that reaches the earth?
    7·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Opp- Nevermind I found the answer = w =
    14·1 answer
  • Living systems follow the law of conservation of mass. Which of the following statements does NOT summarize a key idea of this l
    11·1 answer
  • GIVING 100 POINTS NEED HELP ASAP PLEASE!
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!