1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SOVA2 [1]
3 years ago
13

The phosphorus cycle.

Biology
1 answer:
valina [46]3 years ago
7 0
The answer is C. has no atmospheric component.
You might be interested in
Glycogen reserves can release glucose for cellular respiration. glycogen reserves are typically found in?
avanturin [10]

Glycogen reserves can release glucose for cellular respiration. glycogen reserves are typically found in the muscles and liver.

  • The liver and muscles contain the body's "quick" source of energy, known as glycogen stores.
  • They go through further metabolism after being converted to glucose.
  • After that, glucose can be further digested to release energy both aerobically and anaerobically.

<h3>Glycogen reserves: what are they?</h3>
  • When the body doesn't need to consume the glucose for energy, the liver and muscles store it.
  • This kind of stored glucose, which is made up of many connected glucose molecules, is known as glycogen.

<h3>How long are glycogen reserves good for?</h3>
  • Utilizing the form, you can learn more about nutrition and glycogen.
  • But it's helpful to know that once glycogen stores are exhausted, it will take at least 48 hours to fully refill them.
  • This necessitates rest throughout the recovery period and a high-carbohydrate diet (60–70% of the energy must come from carbohydrates).

To learn more about glycogen reserves visit:

brainly.com/question/11478490

#SPJ4

6 0
1 year ago
The law of included fragments states which of the following?
mart [117]
B. because the rock is formed and it goes younger as it grows the rock is still old on the inner layers but it adds new layers as it goes
5 0
3 years ago
The property of water that allows it to remain unfrozen is known as
Rudiy27
Im not really sure , but it might have something to do with polar chemical compound <span />
5 0
3 years ago
Based on the spectrums in the figure, rank the four galaxies in order of the speed with which they are moving away from Earth, f
zvonat [6]

Answer:

jgkjhnvn iiggkkh ujgkijh

omhko

3 0
2 years ago
Two processes in which water is converted to vapor
Anarel [89]
Its:
1. Evaporation
2. Transpiration
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which disorder is created as a result of the final chromosomal change that is shown
    10·2 answers
  • How can the axis help you determine the season that is taking place in the northern hemisphere
    5·1 answer
  • What’s the cause of <br> Hydrogen Bonding
    6·1 answer
  • What is an autotroph and what is a heterotroph
    8·2 answers
  • Genetic drift _____.
    15·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Why is it possible that two ecosystems with identical conditions of temperature and precipitation, could support different plant
    15·1 answer
  • Pretend your classmate has told you that they are having trouble with what succession is. How would you explain to them what suc
    5·1 answer
  • If the entire universe was shrunk down to the size of Earth, how big would our galaxy be?
    11·2 answers
  • What are biologically determined, innate patterns of behavior? drives impulses instincts releasing behaviors universal behaviors
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!