1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Volgvan
3 years ago
6

Where is this cathedral with an octagonal central tower?.

Geography
1 answer:
bearhunter [10]3 years ago
5 0
Ely Cathedral in Cambridgeshire, England.
You might be interested in
Why do we need time zones?
ivolga24 [154]
So that day and night would be at the same level
4 0
4 years ago
Stellar-sized black holes form when a star explodes in a supernova, leaving behind enough material that collapses to a distance
Vilka [71]

Explanation:

If the black hole will in the solar then it well not take the speed then the original speed

so. if there is no black cell in solar

it well be nice and good to the speed of that lighting

5 0
3 years ago
Which of these layers of earth is the most dense?
VikaD [51]

Answer:

B. The inner core

Explanation:

The inner core is the innermost layer of our planet. It is so dense because it is under the pressure of all the other layers. It releases radiogenic heat into the outer core, which then passes it into the mantle, where it creates convection currents. Convection currents are responsible for tectonic plate movement and seafloor spreading, and therefore, the movement of continents over time.

Please mark me brainliest!!!!!!

8 0
2 years ago
Use "Map Projection" in a sentance
iVinArrow [24]

Answer:

If you look at the Map Projection on the board you'll see all the different oceans.

Explanation:

Hope this helps! Have a great rest of your day!

6 0
2 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • Who controls the Centric government
    7·2 answers
  • Coastal plain disadvantages?
    13·1 answer
  • There are _____ different types of air masses that coming from ____ different locations that influence the weather in North Amer
    13·1 answer
  • Which landforms have a higher population density and why
    13·1 answer
  • 1. Which occurrence is not characteristic of global warming? (1 point)
    5·2 answers
  • Describe what state the body is in when all of these systems are working well
    10·1 answer
  • Question<br> The<br> is found at 0° longitude.<br> Answer here
    7·1 answer
  • Flatirons - Wind River Mountains, WY. The Problem 1 polygon highlights a single flatiron in a tilted region composed of numerous
    10·1 answer
  • 1. Dos ciudades tienen la misma longitud, 15° E, y sus latitudes son 37°25'N y 22°35'S. ¿Cuál es la distancia entre ellas?
    9·1 answer
  • How do animals get their carbon from?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!