1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitriy789 [7]
2 years ago
6

Explain what is smaller than bacteria?​

Biology
1 answer:
Doss [256]2 years ago
4 0

Answer:

Viruses are even smaller than bacteria. They aren't even a full cells They are simply genetic material(DNA or RNA) packaged inside of a protein coating. They need to use another cells structures to reproduce

You might be interested in
Girl come for no age limit​
Levart [38]

Answer:

another who will do my homework!

8 0
3 years ago
Read 2 more answers
Nurse tara is preparing to call the provider . list the findings the nurse include when giving report using sbar format
photoshop1234 [79]

The SBAR format is a communicative framework practiced by healthcare professionals. SBAR stands for Situation, Background, Assessment, and Recommendation.

Explanation:

When nurse Tara is preparing to call the provider, she must provide the following details in the SBAR format:

Situation:  

Patient name/identification/medical problems/Code status/interventions and their outcomes

Background:  

Admission date/Admission diagnosis/a short pertinent medical history/surgery or procedure date/synopsis of treatment given

Assessment

Latest vital signs/new tests and observations and changes/interpretations

Recommendation

Based on present condition/new suggestions /treatment order changes/new consults required

SBAR format of communication is an evidence-based practice that is reliable and adaptable to various situations. This is used by nurses to communicate with the physician in order to report about patient’s condition.

4 0
3 years ago
Lactose a sugar found in milk products is broken down by enzymes. The making of these enzymes is controlled by a genetic system
Anna [14]
I think the correct answer from the choices listed above is option A. <span>When there is no lactose present in the body, the repressor protein blocks RNA polymerase from binding to the promoter, making transcription impossible. Hope this answers the question. Have a nice day.</span>
7 0
4 years ago
how can Keeping track of what food you have and when it will go bad help prevent habitat destruction?
laiz [17]

Answer:

It helps in the survival of organism which leads to prevent destruction of their habitat.

Explanation:

The available food and its shelf life are the information that helps the organisms to prevent destruction of their habitats because it provides information about in how many days the food can be eaten by the organisms which helps in surviving the organisms in the environment in which the food is limited. The wise use of available resources for the survival can help organism to survive in that environment and prevent to stop the destruction of their habitat completely.

3 0
3 years ago
The hypothesis in a scientific experiment is not supported, the experimentis considered a complete failure and must be repeated
zalisa [80]
The answer would be true it is
8 0
3 years ago
Other questions:
  • How much genetic information do gametes carry?
    11·2 answers
  • Gene mutations can be caused by many things. these mutations are biologically important because they
    12·1 answer
  • Describe how changes in an ecosystem can affect organisms that live there..
    9·1 answer
  • The sugar and phosphate portion of the nucleotides are found _____ on the DNA twisted ladder.
    8·1 answer
  • Identify the organelle with the following structure or function with the list below:
    15·1 answer
  • Organisms in which kingdom evolved first?
    9·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Which characteristics describe this rock sample?
    10·1 answer
  • What is the full name of the compound MgO?
    9·2 answers
  • CAN MINERALS BE FORMED FROM ORGANIC MATERIALS?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!