Meiosis and mitosis are both preceded by one round of DNA replication; however, meiosis includes two nuclear divisions. The four daughter cells resulting from meiosis are haploid and genetically distinct. The daughter cells resulting from mitosis are diploid and identical to the parent cell.
so the similarities are:
-ways for cells to divide
-same number of chromosome as the original cell
-both have the basic 5 phases
-both processes go through chromosome replication
-Meiosis II is similar to Mitosis
I hope this is helpful :)))
have a nice day
Answer:
Option B
Explanation:
The seven stars are bigger in size as compared to the size of the sun. Also, these stars are more luminous as compared to sun. However, these stars appear small in size in comparison to sun because of their distance from earth. The larger is the distance, the dimmer is the star. Sun is at a distance of 0.0000158 Light years from Earth while the nearest star of the seven sister i.e Alpha Centauri is 4.37 light years away.
Hence, option B is correct
The RNA (ribonucleic acid) and the associated proteins forms the ribosomes. These ribosomes are the site of protein synthesis in a cell. Inside the stained cell nucleus, the nucleolus part of the cell can be seen. The nucleolus is the part where the all the ribosomes of the cell are assembled.
Hence, the answer is 'nucleolus'.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved