1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naily [24]
2 years ago
11

I REALLY NEED HELP!!! How does insertion, deletion, or substitution results in genetic variations?

Biology
1 answer:
harina [27]2 years ago
8 0

Answer:

An insertion changes the DNA sequence by adding one or more nucleotides to the gene.

Explanation:

As a result, the protein made from the gene may not function properly. A deletion changes the DNA sequence by removing at leats one nucleotide in a gene.??

You might be interested in
The acidic chyme entering small intestine is neutralized by the bile.
MrRa [10]

Once food is in the small intestine, it stimulates the pancreas to release fluid containing a high concentration of bicarbonate. This fluid neutralizes the highly acidic gastric juice, which would otherwise damage the membrane lining of the intestine, resulting in a duodenal ulcer.

Hope it Helped.

5 0
2 years ago
What is the source of energy for thermoacidophiles archaebacteria
nikklg [1K]

There are so many examples for that in different areas, like biology experiment carried out in our lab recently.

Here's one link: https://www.creative-biogene.com/Robust-Tn5-Transposase-EMQZ1422-1271506-26.html


6 0
3 years ago
Based on the scientists results, which of the following is true?
gayaneshka [121]
Well there’s no options
6 0
3 years ago
What can we expect to happen to these strawberry plants
uysha [10]

Answer:

I think you forgot to include a photo but.

The plant will absorb water and sun as the strabbaries slowly develop, once they are finished they will soon be eaten by predadores.  

4 0
2 years ago
How is the process of cell division in prokaryotes different from cell divition in eukaryotics
denis-greek [22]
Prokaryotes do not contain membrane, and eukaryotes do contain membrane.
5 0
2 years ago
Other questions:
  • What percentage of the offspring will be homozygous recessive?
    6·1 answer
  • Explain how diabetes can affect two other human body systems.
    10·1 answer
  • Why do the polar regions have high albedo?
    8·1 answer
  • How will you be able to tell the differences between vertebrate and invertebrate material
    6·1 answer
  • #1 The water held back by a dam is an example of which type of energy?
    5·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The success of plants extending their range northward following glacial retreat is best determined by _____.
    6·1 answer
  • Daryl learns that millions of years ago, Earth's climate went through a
    6·1 answer
  • It was a warm, sunny day. As Ramone was playing outside, he spilled some water on a table. Several hours later, he noticed the
    5·1 answer
  • Please Help ASAP!!!
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!