5. At the end of fall, most deciduous trees lose their leaves for the winter season. In fact, the word deciduous comes from the Latin word decidere, which means to fall down or off. There are, however, a handful of deciduous trees around these parts that have a tendency to keep their leaves past fall.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
Savanna, is a biome, dominated by grasses. It exhibit dry climatic conditions. This biome receives very little rain fall. The tree population is scanty in this biome. The Savanna biome is found in Australia, Africa, South America and India. The giraffe is an animal that feeds upon leaves, fruits and pods of tall Savanna trees. The giraffe is tall enough to reach the highest branches of the trees.
As, in the given situation, more giraffe feed upon the leaves of the trees closest to the ground until all the leaves or vegetation of the ground and closest to the ground cleans up. Members of the population which have taller neck will be able to thrive leaves growing at the top of the tree canopy. This feature is called as natural selection. This involves the survival of the individuals, which have traits suitable for changing environment. The giraffe which have comparatively long neck will have better advantage for survival than the others in situations of scarcity of food.
Answer:
I am going to guess that it is all the biomolecules so...
Protein: Repair the body and helps functions
Carbohydrate: Short Term energy
Lipid: Long term Energy and insulation
Nucleic Acid: Stores DNA and RNA
Explanation:
Memorize it
Answer:Antihistamines
Explanation: I hope this helps!