1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arturiano [62]
3 years ago
8

All the members of a species they live in an area make up

Biology
1 answer:
Vsevolod [243]3 years ago
4 0
A Community or an ecosystem if you include the habitat the animals are living in
You might be interested in
What is the definiton of electromagnetic energy?
ANTONII [103]

Answer:

Electromagnetic energy is radiant energy that movements in waves at the speed of light. It can likewise be depicted as radiant energy, electromagnetic radiation, electromagnetic waves, light, or the development of radiation. Electromagnetic radiation can move with heat.

7 0
2 years ago
Read 2 more answers
PLEASE SOMEONE HELP ME PLEASE PLEASE
Mademuasel [1]

1)  Technique B

2) Because it preserves the harmless insects and targets only moth larvae

Hope this helps :)

8 0
3 years ago
Read 2 more answers
E) Describe a test you could use to identify the gas produced when yeast respires anaerobically
balu736 [363]

Answer:

Describe a test you could use to identify the gas produced when yeast respires anaerobically? Hydrogencarbonate indicator is used to test for carbon dioxide gas produced during respiration. An alternative method is to bubble the gas through limewater and see if it turns milky.

7 0
2 years ago
Which condition causes changes in air pressure in the atmosphere? building clouds rapid air movement condensation of water vapor
Anni [7]

The correct answer is uneven heating of Earth's surface.  

Wind is a result of uneven heating of the surface of the Earth by the Sun. As the surface of the Earth is formed of different kinds of water and land, it absorbs the heat of the Sun at different intensities. One illustration of this uneven heating is the daily wind cycle.  

This uneven heating results in modifications of atmospheric pressure and the wind start to blow from the regions with high pressure to the regions with low pressure.  


4 0
3 years ago
Read 2 more answers
Which is cooled and compressed for transportation along pipelines?
Andre45 [30]
Natural gas is transported through pipelines!
7 0
4 years ago
Read 2 more answers
Other questions:
  • What does the Greek word gymno mean?<br>Olarge/full<br>O seed<br>sperm<br>O bare/naked​
    15·1 answer
  • ​how is soluble fiber in the diet thought to help lower blood cholesterol level?
    11·1 answer
  • Although naeem has no genital sensations, he is capable of an erection if his genitals are stimulated. Naeem's situation is most
    12·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Scientists want to determine how closely related chimpanzees are to humans. Which data would give the MOST accurate comparison?
    6·2 answers
  • an organism had 8 chromosomes in its body cells. how many chromosomes will be in the body cells of the offspring?
    9·1 answer
  • Which of the following determines the type of biome classification that will be made for a particular region
    9·2 answers
  • What’s the answer please help
    10·1 answer
  • What point of action can stop the communication between neurons? Other than NA+
    12·1 answer
  • Because it wears away certain materials, an acid is described as
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!