1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slavikrds [6]
3 years ago
6

Plants take in water, Answer and sunlight to produce Answer and Answer through the process of photosynthesis

Biology
1 answer:
max2010maxim [7]3 years ago
3 0

Answer:

Carbon dioxide, glucose and ATP

You might be interested in
How does mudstone turn into metamorphic rock?
Veseljchak [2.6K]

C is the answer.

Metamorphic rocks is when a rock changes under time and lots of pressure.

Sedimentary is rocks made of sediment.

Igneous rocks are rocks that are made of magma.

Knowing this, C is closest to the definition of metamorphic rocks.

7 0
2 years ago
Read 2 more answers
What would be the first thing you would do if your clothes caught fire while working in a laboratory?
zheka24 [161]
Drop and roll on the floor to extinguish the fire. 
6 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
The growth rate of a population is the amount by which a population's size changes in a given time. In which of the following wa
ollegr [7]

both immigration and births add individuals to a population.

6 0
3 years ago
Describe how dominant and recessive alleles are represented in a Punnett square
just olya [345]
Domininant allels are represented in a Punnett square with a capital letter and recessive alleles are represented in a Punnett square with a lowercase letter.

Example: Dominant - T and Recessive - t

3 0
3 years ago
Read 2 more answers
Other questions:
  • What causes an annular eclipse?
    15·1 answer
  • What might happen to a species if it has to compete for natural resources
    15·1 answer
  • These groups of reproducing populations that are isolated from other groups
    7·2 answers
  • Elephants, who are important grazers, are instrumental in transforming woodlands into grasslands. This has a tremendous impact o
    6·2 answers
  • Which of the following occurs during photosynthesis?
    11·1 answer
  • 80 points
    11·2 answers
  • True or False: A mineral is a natural solid with a random shape.
    13·1 answer
  • Help me please. Its a timed assignment I have 10 mins left.
    8·2 answers
  • PLS HELP BEFORE I DROP OUT
    15·2 answers
  • What is the end result of cytokinesis from a cell undergoing mitosis?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!